GgaINT0064511

From VastDB

Revision as of 17:45, 20 April 2018 by Unknown user (talk) (Adding page)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Intron Retention

Gene
Description
CDC14 cell division cycle 14 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:1719]
Coordinates
chrZ:41733494-41735508:-
Coord C1 exon
chrZ:41735442-41735508
Coord A exon
chrZ:41733557-41735441
Coord C2 exon
chrZ:41733494-41733556
Length
1885 bp
Sequences
Splice sites
5' ss Seq
AAGGTAAGT
5' ss Score
11
3' ss Seq
AGTTGTATTCTGGATTTTAGGCT
3' ss Score
6.01
Exon sequences
Seq C1 exon
GGATGCTTCATTTGGTACTTGCAGTTTTCATCTAACATTGCTAGATTGTTTTCATGCAATAAACAAG
Seq A exon
GTAAGTTAAACAGTATTTTTTTTTTTTTAGTGTGGAACGTCAGCAAATTCTCTGATTGTTACCAGGTTATTACATATTATGCATTGTAACAAAACTTCTGGATGGAACATCCCTAGAAGTGAACATATGCCATGTGTGGTCAACTAGAAAAGTTTTTAAAGGGGAAATGTTGACTTCTATTTAGTTAATCTTTTGAGGACAGTCGTTTGTACCTCTGATCCCTAAGAGCTGCCTAACAGATTTATCAGATGACCCACTGTTGCCTTTGAAAAAGGTTGTGAATTGCTTATTGATGCTTTTTAGGCATTTTCAGTATGCAATTGTAACATGAAGTTTTGCTTCAGTATTATAAATGCAACAATGTTAAAAGGTGATTTTTTTTTAATCATAAATTATCATAACCTCGTGTTTTGTTGCAGTACAGTGTTTACTAATGTGTCATTTTAGAACAAGGAGAATTTGAATGCATTCTTTTTCATCTGTATGAATATTAAAGTGGGGAATTCTGTGGCTCTCCATTCCATTACTGTTTTTATTTTTTTTCATTGTGTCTCTGCCAAATACCGTTGTTTCTATTGCATAAGCCAACTTCTTGCAGTTCTGAGATTTTTTAGGTGTTTTTCTATGTTCTGACATTAGCTGTTCCTTTGCCAAGAGTGGTGAATTGGTATTCTTTTCAATACAGGTGAAGAGCATGGAAAACCACAATGGGCTATGCAGTGAGAGGGAAGATTTGAATTTAATATTCAAAATATCTGGTGTCATGAGATTGTCTACATTTGCTCTTTCTGACTTAATAAGTGATAAACTGCCAGTTACCAAAAGTTTACATTTTTTATACTGTATTAAATATAATGGCTGTAGATAATAAGTAGGAATTCCACCACCAGTGGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCCAGTTCTTAATTAGTGAAGGTATTAGAATCTTAATAGGATCCATACACAAAAATATTTATAATCTTTGAAAACAGACTTCAGAATATACCTATAATTGAAATAGGTAATGCTTGCCACTTATTTTTCTCTTTGGCATATCTTACTACTAGCAGTAGTAAAAAGACAGTACACTTATAAAGTGTGAATTCGGTGGAGACAGAAAGACTTCCTCACATCTAACCTCACTTCTATTATAATTTACAAATCGGGTTTTTACCTGTTTTGTACCAAGACTCAGCTGTTATGTATTTTTTCAAATGAATTAAGACATTGTTCTGAAAGAGTAGAACAAGTAATAAGGGGCATTCAGTAACCTGAAAGAGAAATTAACTGTCCTCACTGAGATGTTATTTCTGTTAAAAGTTGTATTCTGGATTTTAG
Seq C2 exon
GCTTTACAATATGGTTTTCTGGATTTTGATGAATTTGATGTAAATGAATATGAGCATTATGAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000012627:ENSGALT00000020613:6
Average complexity
IR
Mappability confidence:
NA
Protein Impact
ORF disruption upon sequence inclusion

No structure available

Features
Disorder rate:
C1=NA A=NA C2=NA
 


Domain overlap (PROSITE):

Info
C1:
NA
A:
NA
C2:
NA
Domain overlap (PFAM):

Info
C1:
NA
A:
NA
C2:
NA

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Human:
No conservation detected
Mouse:
LOW PSI
MmuINT0032679
Primers PCR
Suggestions for RT-PCR validation
F:
No suggested primer sequences
R:
No suggested primer sequences
Band lengths:
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN