GgaINT0064920

From VastDB

Revision as of 17:45, 20 April 2018 by Unknown user (talk) (Adding page)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Intron Retention

Gene
Description
osteoclast stimulating factor 1 [Source:RefSeq peptide;Acc:NP_001026597]
Coordinates
chrZ:36415332-36415983:+
Coord C1 exon
chrZ:36415332-36415410
Coord A exon
chrZ:36415411-36415884
Coord C2 exon
chrZ:36415885-36415983
Length
474 bp
Sequences
Splice sites
5' ss Seq
AGGGTAAAG
5' ss Score
5.2
3' ss Seq
GGGAATTTTCTGTTATAAAGGGG
3' ss Score
1.82
Exon sequences
Seq C1 exon
AACAAATTGGGAGACACAGCTTTGCATGCTGCTGCATGGAAAGGTTATGCAGATATTGTAGAGATGCTGCTGGCAAAGG
Seq A exon
GTAAAGATCTTCACCAAGATTTCAACAATCTGTATGGCAGACTAGCTTCCTGACTGTTTATGAATGTGTGTTTTTTAAACTCCTTTCCTATAACCCAGGTACAGTCCCTAGCCAGCTTGCCTGCCTGGTTGTGTAAGCATTGCAGAAAATTCTGGCAGCTGTTTGAGAAATAGACTTTTCATCTGCTCCAGATAAATTTTATCCTGCTCTATAGACAAAATCAGGAACTTAGCCCCAGAACAGTAGTTCCATTTGCTTCCTGAAATGGGAGGGAGAACAGCCAACAATTTCCCCAACCAACTGTAGCTTATGGAAGAACATCCTTAGCTTTTAATCTGCTTCAGATCAGTCCACAGATGAGATTTCCTTGTCCAGTACTCTGAGCTGTTTTACCAACGCTACTGAAAATCTTCTCATAATATGCTTAAGTTATACCTGGACAATAAGTCATGATGGGAATTTTCTGTTATAAAG
Seq C2 exon
GGGCAAGAACAGATCTGAAGAACAATGAGAAGAAACTGGCTTTAGACATGGCAACCAATGCAGCTTGTGCTTCGCTTCTTAAGAAGAAACAGACTGCAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000017447:ENSGALT00000038140:9
Average complexity
IR
Mappability confidence:
NA
Protein Impact
Alternative protein isoforms

No structure available

Features
Disorder rate:
C1=NA A=NA C2=NA
 


Domain overlap (PROSITE):

Info
C1:
NA
A:
NA
C2:
NA
Domain overlap (PFAM):

Info
C1:
NA
A:
NA
C2:
NA

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Human:
No conservation detected
Mouse:
LOW PSI
MmuINT0113885
Primers PCR
Suggestions for RT-PCR validation
F:
No suggested primer sequences
R:
No suggested primer sequences
Band lengths:
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN