GgaEX0025047

From VastDB

Exon Skipping

Gene
Description
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:F1NLY7]
Coordinates
chr1:149566057-149576403:-
Coord C1 exon
chr1:149576239-149576403
Coord A exon
chr1:149572397-149572597
Coord C2 exon
chr1:149566057-149566210
Length
201 bp
Sequences
Splice sites
3' ss Seq
TCTGTGTTTTCATTTTGCAGCCC
3' ss Score
11.02
5' ss Seq
GAGGTACTG
5' ss Score
7.67
Exon sequences
Seq C1 exon
GGTCGTTGTACAAGGGAGAACTGCAAGTACCTTCACCCACCAACGCATTTAAAAACTCAACTGGAAATCAATGGCAGGAACAACTTAATCCAACAAAAAACTGCAGCAGCTATGCTTGCACAGCAAATGCAGTTCATGTTTCCAGGAACCCCACTACAGCCAGTG
Seq A exon
CCCACATTTCCAGTGGGTCCCACAATAGGAACGAACACGGCTATTAGCTTTGCTCCGTACCTAACGCCAGTAACACCAGGAGTTGGCTTAGTCCCGACTGAGATCCTGCCCACGCCACCCGTCATTGTTCCTGGAAGCCCACCGGTTTCAGTCCCTGGTTCTACTGCTACTCAGAAACTCCTCAGGACTGATAAACTGGAG
Seq C2 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX2-1/4=C1-C2
Average complexity
C3
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (Ref)

Show structural model

Features
Disorder rate:
C1=0.673 A=0.836 C2=0.654
 

Domain overlap (PROSITE):

Info
C1:
PS50103=ZF_C3H1=PD(51.9=25.5)
A:
PS50103=ZF_C3H1=PU(13.8=6.0)
C2:
NO
Domain overlap (PFAM):

Info
C1:
NO
A:
PF0064219=zf-CCCH=PU(11.1=4.5)
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Mouse:
HIGH PSI
MmuEX0028105
Primers PCR
Suggestions for RT-PCR validation
F:
CTGCAAGTACCTTCACCCACC
R:
GATGAACGCTGCATGTTGCTG
Band lengths:
292-493
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN