GgaEX0025048

From VastDB

Exon Skipping

Gene
Description
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:F1NLY7]
Coordinates
chr1:149566057-149571146:-
Coord C1 exon
chr1:149571066-149571146
Coord A exon
chr1:149566861-149566914
Coord C2 exon
chr1:149566057-149566210
Length
54 bp
Sequences
Splice sites
3' ss Seq
TCGCTGCCTGTTATTAAAAGACT
3' ss Score
2.9
5' ss Seq
CTGGTACTT
5' ss Score
4.74
Exon sequences
Seq C1 exon
GCCAAAATCAAAGCGGCGCAACATCAAGCTAACCAGGCTGCAGTGGCAGCCCAGGCAGCTGCGGCAGCTGCGACTGTGATG
Seq A exon
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCAACTGTAGACCTG
Seq C2 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX2-4/4=3-C2
Average complexity
S
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (Ref)

Show structural model

Features
Disorder rate:
C1=0.330 A=1.000 C2=0.654
 

Domain overlap (PROSITE):

Info
C1:
PS50103=ZF_C3H1=PU(13.8=6.0)
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
PF0064219=zf-CCCH=PU(11.1=4.5)
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
ACATCAAGCTAACCAGGCTGC
R:
GATTGAAAACGGCACTGGCAC
Band lengths:
143-197
Annotated function
There are 1 annotated functions for this event
PMID: 21454535
Inferred from MBNL1: The exon 5 and 6 regions are both needed to control the nuclear localization of MBNL1


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN