GgaEX0025049

From VastDB

Exon Skipping

Gene
Description
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:F1NLY7]
Coordinates
chr1:149561428-149566210:-
Coord C1 exon
chr1:149566057-149566210
Coord A exon
chr1:149562908-149562943
Coord C2 exon
chr1:149561428-149561522
Length
36 bp
Sequences
Splice sites
3' ss Seq
TATCATTGCATGACACGCAGGGT
3' ss Score
3.63
5' ss Seq
TTGGTAGGT
5' ss Score
7.03
Exon sequences
Seq C1 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
Seq A exon
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
Seq C2 exon
TACCCATGATGCACAACGCTACGGCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTTCCCTTCGCCGCAACAGCCACAGCAAATCAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX1-1/2=C1-2
Average complexity
C2
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (No Ref)

No structure available

Features
Disorder rate:
C1=0.654 A=0.000 C2=1.000
 

Domain overlap (PROSITE):

Info
C1:
NO
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
NO
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
CTTGCCAATGCTCAGTTGCAG
R:
GGGAACACTTGTTGCAGGAGT
Band lengths:
114-150
Annotated function
There are 1 annotated functions for this event
PMID: 21454535
Inferred from MBNL1 ortholog: The exon 7 region enhances MBNL1-MBNL1 dimerization properties


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN