GgaEX0025050

From VastDB

Exon Skipping

Gene
Description
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:F1NLY7]
Coordinates
chr1:149544911-149566210:-
Coord C1 exon
chr1:149566057-149566210
Coord A exon
chr1:149561428-149561522
Coord C2 exon
chr1:149544911-149548218
Length
95 bp
Sequences
Splice sites
3' ss Seq
CATGGTTCCCCTCCTGAAAGTAC
3' ss Score
3.97
5' ss Seq
CAGGTTTGC
5' ss Score
4.86
Exon sequences
Seq C1 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
Seq A exon
TACCCATGATGCACAACGCTACGGCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTTCCCTTCGCCGCAACAGCCACAGCAAATCAG
Seq C2 exon
ATAATCCTGAAGTAATCAGCAGGAACGGGACGGAGTGCCACGAAGCCTCCCTGCGGATGGCCAAGCACGGCTACTGTACATACTATCCTGTCTCCTCCTCTCTAGAATTGCCACAAACTGCATGCTAAGTAAAGAATTTGTTCTTACGGACAAATCACAAACTCTAAAAAGCTAGTGCTGCTATGTCATATATGAATATTAAATATGGTATGCTTACTATACTCCGACCTAAAATAGTTAACTACCTGATACCAGCTGTGATGTTTCAAGACATAAAGGGTAACATTTAGTTTCGAAGATTTTCTAAACATAGTTTAATTCTTGCAAACGTTGTCTTTTCTCCATAACTATACCTAATGGAAATGGTCCAATTGAGTTAGCCTTGGGAGATTCGCTGTTCATGAATCTTTCAAGCTCAGCAATAATTAATTTGTATTGGCTAAAAACATATCCCGGTTGCACGTTTAGTTTTAACCCGAACTATAATTGGGGGTTTTCTT
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX1-2/2=C1-C2
Average complexity
C1
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (No Ref, Alt. Stop)

No structure available

Features
Disorder rate:
C1=0.654 A=1.000 C2=0.595
 

Domain overlap (PROSITE):

Info
C1:
NO
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
NO
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
GTGCCAGTGCCGTTTTCAATC
R:
ATGTACAGTAGCCGTGCTTGG
Band lengths:
174-269
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN