GgaINT0123097

From VastDB

Intron Retention

Gene
Description
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:F1NLY7]
Coordinates
chr1:149547545-149566210:-
Coord C1 exon
chr1:149566057-149566210
Coord A exon
chr1:149548219-149566056
Coord C2 exon
chr1:149547545-149548218
Length
17838 bp
Sequences
Splice sites
5' ss Seq
CAGGTATGT
5' ss Score
9.8
3' ss Seq
GCTTTCCTTTCTCTCCACAGATA
3' ss Score
13.77
Exon sequences
Seq C1 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
Seq A exon
GTATGTCGCACCCGCACCGAACCCACCTTGTGCTAGGTAGCCTCCGCAGCGAGCAGTTGTGCTTACCGAAGGGTTACGCTCCCCACCCTGCTTCAGATGAGGCCTGCACAGATAATTTCCATGCTGATTTAATTCCTTCCGCAAAGCGTGAGGGGTCAGGCTGAAACTCCAACATGCCGTTAGACTGCTTGTCATTTTCATAGCCTCCATTATCGCCCACAGTTTGCCCTTTTTTCCTACATTGAATTGGCTGTATTTTGACTTCACCTGCTGGAGCTTTCCTAGGGAATGAGAGGACGAAACACTGCTAGGAAAAGTCTGGGAAAAGTGTATGGCTTTGGAGATGCCAGGGGTGTCCCTTCATGGCCTCTCTGTTGCTGCTCTGCAACAGTGCGCCTTCTGCTTATACCCACGCAGAAGCAACCCCGGAACAAATTGCTCCCCACCTTGATGCTAAAGGGGCTTAGAGGTGTCAGATTGGTTTTCATGGCTTTCCTTTTGGCACGCAACCAGTGCTTTTCCGAGCATTTGCAGCTAAGAGCTGGGGCTGAGCCATCCAGGTGAGCCAAACCTTAGGGGATGTGCTCTGCGTGTCCGCACAGAAGCCTGGGAGATCCAGTCATCCAGAGGGCTACTGCAGCTCGAGCTGCACCACAGTGCTGGTGTTGGGACTCCTTTCTAACACCATGAAAGAAGGAGCACACGGTATTTGCACAGACAGTAACACCAGGATCCTTTAAATCACATTAGACACCTTCACTCCAAACTTTCTGCTGGTGAACTTCCCCTCTACAGAGTGAAGTGTTTTGGTCTGTGACTGACAAGTGTCATGTTCTGGTATCAGAACATTATCAAGGGTGAACATCCAGAATCCTTTAAAACTTCTTGTTTGCAAACACACTTGACATTTCAGCTATGTTATTTTTGCTTATAGAAATAATGCTGGTTATAACGGGGTATGAGACACAGCATGCAAGGATTGCCCGATCTATCAGCATCCCCATATGTCTTTAAAGATGAAAATAAACACAGATGGCATTGACTTCATGTGATTTTGCTATAAGGCCTGAGTAACAACCTTGGAGCCTGCCCCTCTGTTGATAATAGCAAGCTATAGAATGCTGTATTTTTAGCACATTCTTGCAGTAGAATATCTGTGGCAGAAAACACACCGACATTTATGGGAGTGTACGAAAAAAACAGTGGGACTGCCTATATGGATGTGAATGGAAGACCGCCCTATGCTCACCAATGTACAGAAATCTCCACAAATTTATTGTGTACAATAGTCCTAAGAATTTGCACTGTGATTTGCATTATTCCTTCTCTTAAGCACTCCCTTTCGGGGCTTATCACTGCTGTAAGCAACTGCCATAGACTTTAAATTAACTCTGGAAAATAAGAGTAGCTTAAACCTTTTTCAGTGAAAGAACACTTGGAATTTTCCAGACTTTTGGAGTAATCACGCTTCCTGAAGTAGCTCATTCTTTATACCATTTATTGTCCATCCCTCTTTCCAACTGTTGGTTATCGTTGCAGTTTTATCTTATAAATTTCAGATGATAGAGAGGGTGGCTCTTGGAACTAAGTCCTAAAAGCCAGATTGTTGGCAAGTCCAAAGCAAGTGCACAAAAAAAGAAGAGAGGGGGGGATAACACAGGTGAATGCCCATGGTGGAAGGCCTTTCTCAAGGTGCTGAACATCCTGCTCTTGTGAATGCCATCAGCACCTAAAAAGGATGTTAGAGAGATGAATGGGATACGGAAGAAGGCTAGAAAGGGAGAACCCACTCTATATGAATGGGTGTGAGATGAGTTTCATTACAGATAGTTCCCCCGATAGTCACATGTTTCCTGGGAAGTCCCAGAGAAGGTTGGATCCGGTAGGTGTGAGGCCTGTCACATCACCCAGCCCTCAGGAGCAATGCATGACATTATCTATGGGATTTAAAATGATGATGCGATATTTTCTGAACTGGTATAATTTTCAAATGTGTTCCCTGTGTGTGTGTGTGTGTGTATTTGTGCGTGTGTTATAAAAGTTAAATTTTAAGACAAGTTTTGCTGCTGGAATATATATAAAACTTAATTGTTTTATATAACCTCTCTGCTTTCTTAACCACTTGGCTCCCCTAATGACAAGTGTGGGGCTTCACTTAGCATGGCTCATTTCCAGATTTTTGCACTTCACGTGTTTTCCATCAGTTTGATTGCTTCGTCACCTCTCCTTCTTGTTTGGTGAATGATCTCAAGAACAACAGATCTTTTCTCTCCTCTCACTGCTGTTCGTTAGCATTTTTATGGCCGCTAGCCTAGGAACTGTGTGTATTTTCCAGGGGTTGTTCTCCGTAAGGTCATTCATAGTTACACTGCTGCTGGGACAGCTGTAAGCAGGAGTATAGGAAGCATATTTGACTTAGTATCAAATATGTGCGTGTGTGTGTGGTACCAGTCTCCCTGCCTCCTCACCTTCACCAGCTTGCTTTATGCTCTGTGTCGAAAGCACACTGGTTTGTTGTTTGTTTGGTTTTTTTCCTGGTCTTCTCAGGAAGGCTAAAGCCATTCAGCACCAAGACCCAGCGGCCTTTTTGCTGCCGAGTTTGCACACTTTCAGATGTTTAGATTGGGAGTTGTCCCACTAGTCTTTTGTTTTGGTCAGAAACACCTCCCTGCTTCATGCCTTGCGTTAAAAGTGCGTAGGTTAACATTGAGCATCAATTTGACGAAGCCCCTGCAGAGTAGTGTTGGATACTTCCATTTCAGCTTTTTTGGTGAGCGTTGATCTGCTCAGCGTTAAGCTGTCCGAATCATGCAGCGAGCTCTAAAATTGCAAAACAATGTGACATTTAATCTAAGATGTTTCTGTAAACAAAAACCTGTTGCTGCAGATTTATGTACACAGAAACACGCCAAAAGTCATATGCTCGGGTAGGAACTTAATATGAACCTAATCACATCTTTAGCATTAAAGCAAAACTATGAATGACCTTAAACTTTCATTTAACTAACTTATCTGTGGTTATGCTTGAATCTCACTTTGAATGTTAACTCTAAACAGCTAACCTGTTTCTTCCCTTTATCCACTTTTTTCACCTATCATTGCATGACACGCAGGGTCAGTTTTGTGCATGACACCCGCTACCAGTATTGGTAGGTTCCAAATTTCTTTATTGATCTCTTTTATACTGTATATGATGTATATTCACTTGTTTCAAAACTTGTAGGTGAGATTTAGGCAATGACTAGAACTAAAGGCTCACTTGTCCTTCTGGTTGACTTTGCGCAGTGTTTAGATTTGTAGACGAAAGCTGCAGCTCAGATGTGATGTCACCTGCTATAACAACTATACTGCAAAAGCATAATACCATGAATTCCAGTCTGCTTTTCAGTTTTCAACGTTTTATTTCCCTTTATATTGTCTAGTACTATAAAATCATAAAATACTGGAAAAGCCAGCAAGTTTCATCAGTGTTTTAAAGTTTCATAGTGGTGTGCCTATTTCTCCTTTTTGCTGTGTGTTAGAAAGTTTTATCAGCGTTTCCCAGAAATACCTACTTTGATCCACAAAAGTTTGGTTGAAACCCGTGATATAAATCTCACTCCTCCTTTCAATATGTTTACATCTTGGAACGAACATTTTGGGCATGCCAAATTAAAGCCCAACGTGGCAGACTCTAAGACAGGAAAGTAAGATTTCTCCTGTTCTGTAGCTTCATCCCAGTGATTTCTTTTTGTGGCAGGGGAGGCTGCTCAATAAATGGTTAAAAGATTTTTAAAGGTAAGGTTAGTATTCTCGTACAAGGGTGCTGAGCAATATTCATTCTTAAAATGAGCAAAAGCAGCAGCTTTCACACAATTGATCTTGCTTTTTTAGACCAAACAAAGTAGAATTTAAATCAGGAAAATGGTTATCGTCCTTCTGATTCTTGCCTCAAAGCAGAGGGCAGTTTAACTCTGATAAAGTCTAGCAGTCATGCAGTGCTAGTAGAAAAAAAAACCCACACAAATTGGATTATATAGGAAGACGACGAGTATCTGGCTTACTTCAAAATGAAGACGCACGATAATAACTTGTTTTTAATGCTGTTCAAAAATTAAGATAAACAGTTACCATTTTCCTTCCCAGTTCAAAAGGTTATTTTCAGTAGAGTTTTATTTTGGAGCGATACTGGGGGGAAAAGAAAATGGTGTAGCAGTTCTCAGGTAACGGGTTGTTTTGGTAGAGCCCTACTCTTAGAGATAACGCCCGCATTTGCAGTGGTCTCTGCTCTTTTTTTCTGGGAATCGCCGATCGTGTTGACAACCTTCCTTTAATTGTACTTGTAATAAGCTATTTTCCCTTTTTTTTTTTTTTTTTTTTTTTTTTATTTCTCCGCCACGCTTTCTCGCTTTGCACTGTGATTGCATGCCATCTGCTGGTTTAACCCATGACGATGGCTTGCCGCTCTTGATATTCACCATGCCAAAAATACCACTTCTCTTACCATAATGCTGCACCCTCCTGTTCATTGCTTCCATGGTTCCCCTCCTGAAAGTACCCATGATGCACAACGCTACGGCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTTCCCTTCGCCGCAACAGCCACAGCAAATCAGGTTTGCTCCTTTTAAAGCTTTCTTTCACAAGATCCCGAACTCTAAATGAGTGCTGAGATTTTATTTCTTTTTATTTTTTAACAAAAAAAATTCTCCCGGAGAATTTTTTTTTTTTTCTGTGTTTACCCCATCAAATTTTATTTTTTAAGTCGTTTATAGCAAGTGTTTGTGGGACAGGTTGCACTTATTTAGAGTTAGCATTTGTTGCAAATAATGATGTAGCTGTGTTTTGTGTTGCGATGTTTGTACCTAATTAATTGTGTAATTAACCCAGCTGGAATTACAATCACGGTAGTACTGGACTGCTTACGATAGTCTGTTATTAACTCCTAAATTCAAAAGGAAGACATCACAGGTTAATGTAACCTTCTCCATGAGGTGTGTGGAAGTCACTAATGTGTAAGCATGGAAGCTGTCCGAAATAACAAGCGGGAGAAGGCAGCTGAAAATAAGACGGAGAGAAACCAAACGGAATGTTTCCTGTAAATGCGAGTGATCTAAACAGCCCTGGGGGTGTTTATGACTGTGTCTGCTTTATGTTTGAAAGCGCATCTTCAACCTGGAAATAATGTTTCCCTCAGGAAGCACATTGTTACAGCAATTCCCCAGGATTATTGGCGTAAACACAGTAGGCGAGATGAGCCTTTCTACCTTTCCGCTGCGGTTTGTTATGTTAATGGGAGTTTTGATTCTGCTACGGTATCCCCCTCTTCCATTAGGACTGGTCTGTAGGGAAGCCATATGTATCACGGCTCCTCATGAGCAGCATTGATTCCTCCATTCAATTTTTGGAGGCTCAGCGCTGGCTTTTTTCTTACTTTGTGAGTTCCACGAGAGGACTGGGATGCCCCGTTTTCCCTCAGGTCTGGAGAGGTCAAACTGCAAAGCAAGCAGGAAACAGGTTTGCTTCCCAGAAGCAAGGAAAGGGCCGGGACTTGGTCACATCTCCCAGTGTTGCTCCTGGCCAGGCTGCAGGCCAGGCAATCCTCTCCCCCTGCCAATGAGTTATGAGGAAATCAGTGAAAATCTTTCACTTAATGATGCTGTACCAGCAGACTGATATGTTCTACATTTTTCAGAGTCACAAAACAGTTTTAAGTATCCCATGGAAAAACAGAATTTGCTCTGAGAGTTTATTTATAATAACCTAGGGAAAATATACTACCTCTGAAATACACCCCACTTTATAAAGAAACACAGCCTAGTCCGTTTTCTCTTCAGTTTTTGAAAGGTCCATTTGCCAGCGTTGCAGTGCTTTCTGCTTCTATAGGTGTTTTCATCAAAAGAGAGTATTCATTTTGTGCACTCCTTCCTAAGGGCTGGCTTGTTTTAATGAAGAAACACATGGTGTGTACAGGGAGGGAGGTGTACCAGGCAGGTGCTGCATTTAACTGTCCTTCCTTTTGGCATTTTAGCTGTGGTAGTGCAGCGGGCGGGTGCTGGTTGGGTGGGCTGAAGGGCCTGTGGGGTGCTAGGTGCCTGGTAGTGAGCATGGAAGAAAATGTCTGCCAGAGGGTGGCCTGGTGGTACCCAGGGCAGTTCTGGGGTCCCATAGTGGTGACAGAGGGGTTTGGGAATGGAAAATGAGAAAATGGGACCGTTTTGGGGAGCGGCTCAGCTGAGACCCTCCCTGCACAATGCTGCGAAAGGTGCCCAGGGAACGCACCCAAGCAAAGGACTGGCAAACATTCAGGGTTTTTTTAACAGGGAATATTTCACACGAGTAACTAGAACCAGTGGGGAGACAGAGATGTGTCTTAATGCATTTTCTCATCTCGGAGGACAGCAGGCAGAGCCCTTCCATTCCCGGTGCGGATTTTATTTGCATTGGAGGATTAGAGCAGTTTGAATTTACAGTAGTTGTACAAGTGTCTGTTGGTACTTATTTGGTTACATCTCTGTGTGTGTGTATACATAATTCCACGCTGAAATTAAAGGATGGTTTAACACAGGGATAGGTTTTCACTTGTTTAACTTCAGCCACTTGGCGGCTCAGCATCCAGTTCATCTGCTTTTCTGTAAGTCTGTGCAGGGGTAACATGACTTGCCCTGGAGGGTCCTGCCTCTTTCTGATGGCTTTAAGTAGCTCTAAAAGCTACTTTAAAAAAGAGCTGCATTTAAAAGTAGGTAAAGTAAAAGCAGTTATCCTTACAAGAGGCAAATCTCCCAACTTTGCTGCTTATTTATAACCTCCTAGAGTTGGAGACCAAGCTATGCTGGAAAGGGCCCCATGGTAACTCTGTGCTCCTAGCCCTTGGTATTTCTCTAGCCCAAGAAACACAGAAGTAGCAGGTCATTAACTTGAGTTCACCTGTTAAGACTTAGCTCATGGTCATCGTGTCCTTTGTTTGTGTCCCTTTGTATACATTTACACTCTCCTGTGTATTTCAGAAAAGGATATCTTTTTTTCCCATCTAGGTAAATTTTCCTTTTCTGACCTGTGCCAAACCACAGACTGAGTGCTTCTCTGTGGGATCCAGTTTCTTCTTTCCAGTGTATCTACTGCATTTTTTTAAATCAACCTGCAGCCTTCAGACTGTCCTGTTTCTGCTCCTACAGCTTCTTCTCACAATGCCAGGCATGAAAGGAAAGTCATAGCAGTGCTTAATTGTCTGGCTCAGTATCTTTTGGCTTAATGTTCGAGCCTGGGGGAAAGACTGCTCTACTTCCTTTGGGATCCTAGGAGCACCAGTGGGAGGGAACATCAACATCCCAAAAGCCAAGGAGTCTCAGCTTATGGCTGAAAAAAACCCTAATAATTCTGTAGGGTCCAGAAAATTATTCAGCATGTGCAAACTGTACTTTGAAAGATGATGTGTCTTGTACCCTCTCTATACATTTCTTCTCTGAAAGTAATAACTGGGTGCAAAACATGCCTGCGTTGACCCACTCGTAACCATTCATGCTCAGGTAGCAGCTCTCAGTGTTTTCTGCTCAGCATGCGTGGGGTTGAAGCCCAAAGGAAGACTGTGTTGGATTAAAAACTATGCCTTAGTGCATACATGCAGGGGGACTCAATTAAGGACATGAGGAAGATTAGGAGTCTCTTGCTTTTCCTGATTACATAAATTAAAGAGATGAGAGGAGCCCTTTGTAACTAACTAACTCCTTCCCCTTTTCCCCTTAACTCATTCACGACTGCTCCAGTCATGCCCACTGGAATGGTGCTGAAAGCTGCAGCTGCTTAGCCTGCCTTTTGCCTTAATGTTAGGTGTTCAGGGTTGTGAACATAGTCTTGCAGGGTGGAACCAACAAAGTCCCACGAAGCGTGGAGTAACTGGGAGAAGCGTCAGGGAGAATGGAGGACTTGGCACGGGCTCCCTCTAGTGCATGCGAGTGGGCAGGCATATGCCAACATCTCATTTAAAGCATTAATAGAGTATCATTGTGTGTAAATACATACTTCAGGTACCTTTAATAAAACGTGTAATTTTTATTCATATTCAAATAGTGAACTAGGTGCACTGTGTAACTCAGTGCACCTAAGCAAGCAGATCAGTTGTTCCCTACTCAGCTTCGCTCAGAGCTATTTGTGAGACATCAAAGAGGACAGTCTGCCCTGCCATCACTTGAAAGATTCGGTGTTACTCTGAATTCTGGTGCTGAATTACGATTTTCAGTGATGCCAGCATAGTTGATTGCATTGCCTAAATGTGTGTTGGCTGACATTTCAGATTGTCCCACGATAACCTTGAATGTCTAGGTTATCCAAGACAGGCTTGGCAGATACAGCACAGGACCTGCTGGGCAAACAGGCACACTTCTGAATATGCAGCTGGATGGCAGGGAAGAGACCTGAGCCCAAGCAGTAGTGAAGTCTGGTGCGCCTGTGGCAGCCAATCCCACTAAGGGATCTCCAGACTCCACTGACCTCCTGATGAGATTGTACCACACCGTTGACTGCCATTGGAGTTCAAACGCCACCGTTGATGTGTTTTAGTGTATCTTCAAGCTCAGTGTGTGCTTCCTTAATTGTTGGTCGCTACAGAGTGATTAACAAATTCCAGATTGCTTTAAAGAAGACAGTCTTGTTGGTATCATTTCAGTACAGAACAGTACATGCCTTTATTTTCTATAGCAATGCAGGTGGGCCAGAGACTGACTATGTCAAAGGAGTATTACAGAAAATATTGGTTAGAGATGCTAACACAACTTTATTCTGCTGGTTATGTGACCTTTAGCCAAGGAACAGAAATTAAAGGGCAGATCTAGTAGAAAAATGAACTACTTACAGGCTGTGTCTGAAAAGAATTATAAGATCAACAGTCTCTCTCATGCTAAGGCTTGTGATTATCTAGCACAGCTGTTTTAAATTATGTATCAGTGTTCACACTAAATGAGGTGGTAATTATGCAGATATTAATTATGAAATCATTTGTTAGCCTTCAGTTTTGTGAAAATCTGTAAAAATACAAAGAAGTGAAAATAAAAATGATGTGTTACATTGCAGTAGCACAAACAAGGGAACAATCCAAATACTTGCCTCGGAATTCACCAAGTCATTAACATTGCATAAAATACAAATTTGCCAAATTCTTGGTAGGGATTTGAGAAGCCACGTGTGGCAGCTCCCTCTGGTGTGAGGGGAGCGGGGAAGTGCAGCATGAAAACACCTCTCTTGGCCAGGAAAGGTGTGGGGCTGCCCAAAAGGCAGGTTGCCATTAGGCTGAAACATCCTGTGGCACCTACTGAGCCCCAGGCAAGTGAATTTCTTCCTCTACACTTGCTCCCTCTTGCACATAAAGCACCGGGTCCCCCCAAAAAAGTCATAAAGTCTGATGGTGGTTGCACGCCTCAAAGTGCTGCTCCAAGTATTTCCATTTTAACTGGACAGTGCCCCAAGCAGCTGCTGACATCAAACTGGTGAAGGCCAACAATTATCCTGACTGGGTTGGCGGAGTCTGGAAAGGCATAGGAACAACTCCTCATCACTTATCTATTTTGGGGGAAGGATTTAAAGATTTCTTTCCTTTCTGTGTAGCAGCAAAAGGTGGAGTTCTCGGTTTGCTGGGAGGTTTGTTTTATCATAAACTATCCTTGATTGTGAAGAGTACCCTCCAGAGAACATATCTGGAATAGCAACAGTACTTTGTGATGTGAAAGGCAAATTGAAACTGTTTGCTGCCTATTTCTTGCTAGATACCTCAGAATCAGAAGCCTCAACTCAAACCAGTAATAAAGTCTGAAGACACTGAGTCACATGTAAGTAGCCATAACTTTGAGAATTACGTTTTCAGACTCAAAGGCCACAGCAAATGTCAAGCAGTGTCACGAAAAGACCTTCTGAATTGCCTTGAAACAGCCGGCATTACAAATTGTGTGGCAAAACTTTGTTTTCTTAAACTGTAAGGCAGCAAAGAAGAGAACATCGAAGTCTACCTTGGGGAATTTGAAGGAAGTCTATTTTAAATCTTATGCGAACTTTAACTATGTCTTTATTGTAATAACATTTTTTTGGTCTCTTCAGCTCAGATATTGGTAATTCCTACTCCCACCACCACCAGTCCTGTAGGGACTGCAAACTGAACCTGACTTCCCCTGGTTGCCTGCTAGATGGCAGCATCACATAACCTGAGCGCGTAGCAAAGGCAAACACATTTCTTTTGTGTAACAAATATCCAGGCGTATTTCCCTTCCCTGTCATAGACTATGTTAACTTTCATAGCATCACGGTTAGTATAATGGAGTTGTTTGATATGATAGCTTTCCTTTATGCTCTTTTGTTCAATTATTCAACAAATGGTACTTTGACAAGTTGAGTAAAAGTCTCTTGGGGCCTCTATTTATTATTTAAATGTAGGAAAATTTTCCCGAGGTCAAGTGATTTTGTAGGCATTTGTGGGGAAAAAGTGAGTTAGTCCCCTTGTTCTTAGCATGTGCACACAGCTCGTATCAGCCTGTTTTTTTCCATCATAAAATTTTAACAAGACAGCGCTATGCAGAGCTCCAGATGTATTTGCTTGGGATTCTGCTCTTTGAAGTAATTGTGTCTGTACATCTCTAGCTGCTTCAGCTATTTGCCCTTGAAATGAACTAATACCATATTTTTTATCTTTGTATATGATTTATTGGATGAGCATTCTGCCCACCAGAAATGCCATTCTTTGGCCCTGAGCGTGAAGGAATCTGCCCACAGAACTGCAGTGGAAATATTGACTTATTTATTTGTTGTACCTGCCGTGTCTTTCAGCTTGAGGCAGAGGTTTGTTAACTTTTACAGCTTTCACTTTCAGCACAGTATTATGTGCAGTGCCACACAAGCTTACGTAGATGTGTTTACATAGAATGAACCATGGAATGGTCTGAGTCAGAAGGGACCTCTAAGGTTCATCTAGTTCCCAACCCCTGCCATGGGCAGGGAGATATGAAAGTATTCAGATAAGAATAAAAACAAGGAAGTGGTAGGTAGGTCATTGTGAGGATCAGTAAGTTTTCCTTAGAAAAGTTATAAATGTAGTGAGTTTCATAAAACTAACAGAGTTCATTAACTGAGATCTGTCCTATTGTAAGTGCGATGTCTGATGAGTAACCTTGGTGAGGAAAATGTAAATGTGGTGCATTTCTGTGTTCAAGAGAAGTTTTGGATGCAGTAGTGGAGCATCGATTTGTGTTTGCCTTGTAGTGGAAGGCTCATTTGGAATGCGGGCTCATCTTGAGCATGGGCTCAACTGAAGTGTAGGAGGAAAACAAAATAGGTTTTGTAAAAATGTGAAGTAAAAAAGATACTGGATGAAGGCAGCGGTCGAAACACAAGTTTGAAGAAGCCCAAACTGCATAGATCAGGGATAAAAGAGTGAAAAGCTGTAATCTTGATTTAATGAGAACTTGATCTTTACTATTTATAATAAACCACTACTGTTTATTCTTATAAAGGGAACTAAACATACCAAAGTCACAGAATCACAGAATGGATTGGGTTGGAAGGGACCTCAAGGATCATGAATCTCCAACCCCCCCTGCCACAGGCAGGGCTGCCAACCTCCGCATTTAATAGTAGACCAGGCTGCCCAGGGCCCCATCCAACCTGGCCTTGAAAGTGTATTTGAGAAACTCGTAACGTTTTCCTTACCACTCAAGAGCAAAGCCTATGTTTGTCCCTTTATCTGACCCTTTGGATTCATACTGAAAAAGCATTGCTATATCTTGCCCAAAGAAACTAGACTGAATTAGCTTGCATTGGTACATGGCTACATGTTTCATTCTGGAGGTGATGATGTGCAGTTTTGGTTATGTTGGCTGCTAAACCTCCCACTGGGTAGAATACACAGACTTGTTAGCAGACCCCAAAGATGCAAATAATCAAAGTAAGGGGGCAGGTGTTTTACCTCAGCAGTCTTTGGCAAGTGGCCAGAAGGACCGATGGCCCTTGAAGCAGAGTGGGACTGGGGCAGACACAACTGGGAGCACTCAGATTTAAGGAAGAAAAGGATGGACCAGGGCACCAGAATCACCATGTCAGGGGATGGACTGTGGGGGAAAAAAAAAACAAAAAACAAAAAAAAAAAACCAACAAAAACAAGCAAATAGGACCTCAGCTCCTCAGGAAACACATGATGAACCCTGTGTTAGTGACTGTGTGGGAAGACAACCCAGAAGATCATCTGTGGCCTGCAGACCTCACATAAAAGCAGAGGTCGCCTCATTGATGGGCAAAGTAGACAAATGCATTGGGAATGCACTGGATAAATGGAGAAGCAATAAAATAAAATCCTCTTCACTCCTGAATTAAAGAGAGGTGCACAGTTAGAAAAACAAAGTAAGCAAACGTTAAATAGTCTGGAAAGGAAGACAGGCCTTCTGGCCATCTCGAGAGCAGGGGCTGCAAAGGGAAGCAGCCAGGGACACAAAGTGGGGTTAGGTGTGTTTATGAACAATGATGAAGCAATCAGCAGTGCTGGTGGGGGACAGGGCAATAACTAAGGTGGGTGAGATGTGGAGTATACCCAAGCAGCCCTCCAGCAGAGTGTTTGGAGCAGGCAGGCTGCTTTTTGTGCAGGTGGCTGAAAACAGGGTTGGGTCCCATGCCTTGAAGCAGCATTGGTGGGAGTCCTGGAGTGGGGCACTGATTGACCAGGGAGAAATCAGAGGTAAAAGAAATCAATCTGCAAGACTTGGTCATCACCTATGACCAAGTAGAACTGATATGATGGTGAGCACTCTCAGTAGATGTCTGAATATTTTCAGACATTGCCTGAAACTCATCCTTTTCCATTTTTGATTGAGAAAAAAGGGAGGCTGATTCACTGTGAAGACAAAGAACAAGGCACATGCCATAAAAGAGCATTCTAAGAGAAAATGAAAAATAAAGAGATGAAGGCACTTCCCAAAGGCTCTGGGGAATATAAATAGTCCTGGGTTTCATGTCAAAGGGAAGAAATGCTTGGTGTTGGTTTTATTTTTAGAGAGTGGGAGAAGTTATGAGACAGCCTGATATGAGCAGGCTGCCTGAAAATATCTGTCGGTTTTAATGTATATCCCTCCTTACGTCTGACCATCCTGCTCCTAGTGTGAAAAACATGAAAATGGAAAATGTCACTGTGGTAGGAGGCATCTGCCCTGACGCAGATGGCTATGAGTTAAGTACCTCAGTGTGAACTGCTTGCCACAGACTCTGACGTTGGGTGGAGGGAGAAAAGCATCATGAGTTTGTAATTTGTCTCATGGTAAGATAAGTTGCCTGAGGTAGGGTAGTAAGATGTGAAACAGGGTGACCGGCTGCGGCTTGCATGTCTGAAACCATCTGACATGTCTGAAGAGAACTCCTATTAGTACATTGCTCTGAAGTTGAAAGGCTGAGATGTTTACTGCATACAAGTTCATTTTTGAAGGGATAAATGCTTTGCAGTGTGGAGGTCAAGAATGGTTTTAATCCCACCTGAGAAAGTATTAACACTCATAAAGTGTAATTTGGAGAATTGAGAACTTGGTAAAGAGAAACGTCTCCTGGCTAGATGCAAAGTCATGTTTTCCAGCATATCCACTGTGACAGATCTCTGAGTTGAACAAGAGTTCATACGCACTGAGTTCATGCAGCATGGTGCATTTTCTGTGTTCATCATTGCATAATAAGTCTGGAACCAGAAGCAGAATAAAGCACACACACAGAAGTTTCATGAGTTGCAGGCCTGAAATCGGTAGTAGCCAGTCATGATCCTTGGGAATTCAGGTAATTATGTGAATGGCATTAAGTAAAAATTGAGTACTGCGTCCAGGCCTGGGGCCCCCAGTACAGGAAGGACGTGGAGCTCTTGGAGCGGATCCAGAGGAGGGCCACTAAGATGATCAGAGGGCTGGAGCACCTCTCCTATGAGGAAAGGTTGAGGGAACTGGGCTTGTTTAGCTTGGAGAAGAGAAGGCTCCGCGGAGACCTCATTGCGGCCTTCCAATACTTGAAGGGAGCATATAGACAGGAGGGGGAACGGCTGTTTACAAGGGTGGATAGTGGTAGGACAAGGGGGAATGGTTTTAAACTGGGACAGGGAGGTTTAGGTTGGACATTAGGAAGTTTTTCACACACAGGGTGGTGACGCACTGGAACAGGTTGCCCAAGGAGGCTGTGGATGCCCCATCCCTGGAGGCATTCAAGGCCAGGCTGGATGTGACTTTGGGCAGCCTGGTCTGGTGGTTGGCGACCCTGCACATAGCAGGGGGGTTGAAACTCGATGATCATTGCGGTCCTTTTCAATCCAGGCCATTCCATGAGTCTGTGATTCTATAAAAGAGTGCACAGGGTAATCTAGAGGTCAGAAAAGGTTCGCAAATGTGGAATTTCCACCTTCATCTGAAAGAAGCTGTCTGTTTTACACTTAAGTCTTGAGACAGTAAGCACTCACAGCCTTCTCTGCTGGGTCTGAGGGAACTGCAGGCTAACGCTGAGTTGTTGGGAGCTAAAAAGCCAGCTTTTACAAAAAAAAACAATCGAACTCTCAATGGCAGAAATTCAGATCCCCTCCATGTACTACCAGTTTCATGAGGTGTAGTAACTAACACCGGCACTATGTCAGTGATTTTAGTCTAGAGAGTGGCAGTCTCCAGCACTTGATACAGGCACTGAGGAAGAAGGCAGTGACATCTGTGGCTCAGAACAATGCTTTTTGCTGTTATTAAATCTTCTGTGCATTACTGTCTCAGTCTGCAAGTGCCAGGACATAGTGCTTTTGCTAGAAATAGTGTTCATATTCGATCTGTTTCTGCAGCAGCAGAAAGTCTCTTTTCCTTCATGTCTGTACCCAGTCCTGCAGATATGGATGTGGTATTATCCTTACAGAGCATGAGAAAGTGCTTTCCCATGCTTGAGCCGTAGACCATTGCACATGGGAGCGTGTGCATAACCACACACGAATGCACGCTCATTGTGTAGCTGTATTTTTCCATTTGTTATGCTCACATGTACCGTGGTGTCGATACATTACATCGAGTTGTTGGGAAGTTTAATGAATGTAATAGTATCACAGCACATGGGATGAGTCATGTGCATGTACATAAGGAGATGTAATCCTTCCAACAGGATTTCTGGTTGTTAGACCTCTTTACAAGTAATGGGGGAGTGGAGACTGCAGTAAGTGTTTGCAGGGATGTTCCTTGGTCACTATGGTCTGTACAACTTCTCCTTGTTCAGCGTGCAGGCAGTGGAGCAATTAGCAGCGATGCAGACTTAGATAGCTTCCATGTTCCATCAGAGCTTATTGCTTTGTTTGTAGGTTAAATGGGAGAGGTTCACTGCGTATTTTCCACATAAAGTAGTTTACCGTTTTGTGTTCCTCTGTCAGACACAGTGAAAAAAAACAGTTGCAGAAGCTGCTACACGTGTACGGAGCTGTGGTGAGTTGTGATATCTTGGGAGAAATAGGGTGTGAAGATGTAATTAAAGGCTATGGGATGCATTTTACACTTTGTGGCTCAGGTTAGAAAAGAAATGTAGATCCTCAGTTCTGCGCCTCTGCGCTGGAGAAGCTGCTTCTGAAGGAGAGACTTGAGGTTTTTTCCTCAGAGGACTCCTACGTGTGCTAGGAATAGCCAGGGTGCAACATGCCCTAGTTACACACTGCACGAGCGTTGGGTTTGCAAGGAAGATGTGCTAGGGACGAGCTGGGAGGAGGAAGATGCAGTGGAGTCAAACATGGGGGGGAGAACTCCAGCTGCTGTCTGCTCCCCTGCACCCAGCACCACGTAAACAGGACGTGCACACAAAGGGGAAGCGTCCGCATTGTCTTCGCTTCTTCCTGAGTGCTGAGAGTGGGGGACAGATGGCAGGATGGGGCTGGGATGGCGGAGGTCCTCACCTGGACCCTGCTGCTCACCTGAGTGGTGAAGGGAGGGGGGCCCAGCTCTTTCACGTTGCCCACAGCTGTCCCGTGTTTTGGAGGAGCCGGGAGCATCGGTCCAGTTTGGTCTCTCGGGACATCTAGAAGTGGCAGTGATCTCTCTGCCTCTTTGTGTGTTTCTGAAACAGTGGTGCAGGGAGAAAAAAGTGAGAGCAAAAAGCAAGTTCTGTCCCTTCAAAAGTTGCCAGGGGAGATAGGCAGCTGCAGTATCTGAAATCCTAATTTTTAAACTGTGTAGATTTCAGGTTACGTTCCATTAAGCCAGACTTTAGGATCCCTTAAATACATTTGCGTGACTATGGCTAACCCAGTATAGCTAAAGCTGCTTTATTAATTACATTGACATGTTGGGTCGTAACATGCTAAAAATACCAGTGCTGATAATCTCGGCCACTTCTTATTTTCAGCACGGCTTTGTTCTTTGTACTAACTGCCAAGTTACAGTGCTGTAGATGGACCAGGATTATCACAGGCAAGGCTTTATTATTTCAGCAAAGGTATATCTCTGTTATTTCAATAGGAAACAGCAGATAGACGATAAGCCCACAAACTCACAATGAGTGGAAGTCATTACAAATATATGTCCTTGTTGTAACTATGATGTATTTAGACGTCCAGCCCTTTGGAGTGGGAGTCACCAAGTTATCAGTGATGATAAGAGATAACTTTCAGGCATGCCGGCAAGTTAGACAGGGCAGTCTACTCACTGGCAGTCCTTGTGGCATGCTGTGCTGTTCCTAAAGCCCTCCTTGGTGCACTGGGAATAGGACAGTGCGGGGTTGCGAGGCGTGTTCAGCATGGTCTCAGGGTGCCTTGGGCAAGTGCTTTCCACACAGTGCTGAGCGTGTTTCTTTTCTGTATGTCAGAGGTAGTATGTTGCTGAAGTAGTTTTCAAAACACCTTTTTTCTTCCCCTTTTAAAATAAATATTGCATTAAGCAGCGGTCTGTCTGCTTACTACACAAGTAGGTCAAAGTGCTGTCATGCCTGTCTTGCAGACTACCTACAAACACAGCTTAAAAATACACAGAGTGCCAAATCAAACAGGAAGAGCAAGCGATGCACTACAGTTCCTTGACTTGTGCTTCGGTCTGGAGTACAGATTAGCAACAGCGTGGTAAAACATCAGACCCCATGCTTTTGATATCCCATTCACCGACAGCCCTTTATGTGGCAGAGGATGGAAATCCAGATCACGTCCCACTACTGCGTGCTGGTTGAGTCAATTGCCTTCGTGTTTTGGAAGCTCACATCCTGCCCAATACCATTGCAGTATTGGAGGCACAAGAGCTTGCATCTGCAGAATGGTTGCTTCAGCCTTCGGAGGCAAGCTGGCAGGTCAGCGACCGGCTGGACGCACAGGGGTGCCTTTAGGACAATCCCACAGACCTGCTGGTGTGAGGAAGCGTGAAGGAGCTCTCAACTCACTGACCTACAGATAATGTGTTAGAAAATTAGCAGTTGCTAGAAATGCATTAAAAGAACCCAACACTTTAGCTTGTCACAAACATCCAGCCCAGTACACCTTTTTTTTTTGGCTTGGTAGTGGTGAGCAGCCCTGCCTCCACCTCTGCCCCATGCTCTTCCCCGTTTGGCTGTCACAAGGAGGTGGGCACTGGGGGCTTCCCCAGCCCCCTGGAAAAGTCCAGAGTTGGGGCACCTTGCTGGGTCAGCCTCCTGCCAGCATGGTTCCCTCTCATGTTTTGTTACCTAAACCAGTGGAGGGTGCACTGAGCAGGTCTGTGAGACTCACGGGCTCCCACCCAGCATTCAGGGCATGAGAGGCTGTCCTGTAGAGGCTGGCTGTAGTCAGAGCAGTGCCGCCCATTTTGGGGACTCGGCGGCCTCACCCAGCGGCGCGATCACGCTTTCCTTTCTCTCCACAG
Seq C2 exon
ATAATCCTGAAGTAATCAGCAGGAACGGGACGGAGTGCCACGAAGCCTCCCTGCGGATGGCCAAGCACGGCTACTGTACATACTATCCTGTCTCCTCCTCTCTAGAATTGCCACAAACTGCATGCTAAGTAAAGAATTTGTTCTTACGGACAAATCACAAACTCTAAAAAGCTAGTGCTGCTATGTCATATATGAATATTAAATATGGTATGCTTACTATACTCCGACCTAAAATAGTTAACTACCTGATACCAGCTGTGATGTTTCAAGACATAAAGGGTAACATTTAGTTTCGAAGATTTTCTAAACATAGTTTAATTCTTGCAAACGTTGTCTTTTCTCCATAACTATACCTAATGGAAATGGTCCAATTGAGTTAGCCTTGGGAGATTCGCTGTTCATGAATCTTTCAAGCTCAGCAATAATTAATTTGTATTGGCTAAAAACATATCCCGGTTGCACGTTTAGTTTTAACCCGAACTATAATTGGGGGTTTTCTTCTTGGTTAAAAAAACTCCTGGTTTTGCTCCCCGAGTGATCTGACTCCGAGAGGGAGGAAGTGCAACAAAGCCCGGCGTGCTGCACGTCACCCTGCCAGTCCAAAATTTTTAGCCAGAAACCCAAAGTAAAGCACAAATTCTTTAGATGCACATGGTTGGTGTTTGACATGTATG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890:ENSGALT00000030196:6
Average complexity
IR
Mappability confidence:
NA
Protein Impact
Alternative protein isoforms

No structure available

Features
Disorder rate:
C1=NA A=NA C2=NA
 


Domain overlap (PROSITE):

Info
C1:
NA
A:
NA
C2:
NA
Domain overlap (PFAM):

Info
C1:
NA
A:
NA
C2:
NA

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Human:
ALTERNATIVE
HsaINT0100452
Mouse:
ALTERNATIVE
MmuINT0096309
Primers PCR
Suggestions for RT-PCR validation
F:
No suggested primer sequences
R:
No suggested primer sequences
Band lengths:
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN