HsaALTA0000001-2/2

From VastDB

Alternative 3'ss

Gene
Description
APOBEC1 complementation factor [Source:HGNC Symbol;Acc:24086]
Coordinates
chr10:52573617-52576039:-chr10:50813857-50816279:-
Coord C1 exon
chr10:52575766-52576039chr10:50816006-50816279
Coord A exon
chr10:52573799-52573822chr10:50814039-50814062
Coord C2 exon
chr10:52573617-52573798chr10:50813857-50814038
Length
2424 bp
Sequences
Splice sites
5' ss Seq
GAGGTAACA
5' ss Score
8.1
3' ss Seq
ATGCCTTCTTACGTTCCTAGAAA
3' ss Score
8.45
Exon sequences
Seq C1 exon
GTGCTGGATGGTTCCCCCATTGAAGTCACCCTAGCAAAACCAGTGGACAAGGACAGTTATGTTAGGTATACCCGAGGCACAGGTGGAAGGGGCACCATGCTGCAAGGAGAGTATACCTACTCTTTGGGCCAAGTTTATGATCCCACCACAACCTACCTTGGAGCTCCTGTCTTCTATGCCCCCCAGACCTATGCAGCAATTCCCAGTCTTCATTTCCCAGCCACCAAAGGACATCTCAGCAACAGAGCCATTATCCGAGCCCCTTCTGTTAGAG
GTGCTGGATGGTTCCCCCATTGAAGTCACCCTAGCAAAACCAGTGGACAAGGACAGTTATGTTAGGTATACCCGAGGCACAGGTGGAAGGGGCACCATGCTGCAAGGAGAGTATACCTACTCTTTGGGCCAAGTTTATGATCCCACCACAACCTACCTTGGAGCTCCTGTCTTCTATGCCCCCCAGACCTATGCAGCAATTCCCAGTCTTCATTTCCCAGCCACCAAAGGACATCTCAGCAACAGAGCCATTATCCGAGCCCCTTCTGTTAGAG
Seq A exon
AAATTTACATGAATGTACCTGTAG
AAATTTACATGAATGTACCTGTAG
Seq C2 exon
GGGCTGCGGGAGTGAGAGGACTGGGCGGCCGTGGCTATTTGGCATACACAGGCCTGGGTCGAGGATACCAGGTCAAAGGAGACAAAAGAGAAGACAAACTCTATGACATTTTACCTGGGATGGAGCTCACCCCAATGAATCCTGTCACATTAAAACCCCAAGGAATTAAACTCGCTCCCCAG
GGGCTGCGGGAGTGAGAGGACTGGGCGGCCGTGGCTATTTGGCATACACAGGCCTGGGTCGAGGATACCAGGTCAAAGGAGACAAAAGAGAAGACAAACTCTATGACATTTTACCTGGGATGGAGCTCACCCCAATGAATCCTGTCACATTAAAACCCCAAGGAATTAAACTCGCTCCCCAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000148584-12-15,12-14-2/2
Average complexity
Alt3Alt3
Mappability confidence:
NA
Protein Impact
Protein isoform when splice site is used (Ref)

No structure available

Features
Disorder rate:
C1=NA A=NA C2=NA
 


Domain overlap (PROSITE):

Info
C1:
NA
A:
NA
C2:
NA
Domain overlap (PFAM):

Info
C1:
NA
A:
NA
C2:
NA

Degree:
NA
Betweeness:
NA
Associated events
Primers PCR
Suggestions for RT-PCR validation
F:
No suggested primer sequences
R:
No suggested primer sequences
Band lengths:
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image
UCSC image

INCLUSION PATTERN