HsaEX0031839

From VastDB

Exon Skipping

Gene
Description
insulin receptor [Source:HGNC Symbol;Acc:6091]
Coordinates
chr19:7267356-7293942:-chr19:7267345-7293931:-
Coord C1 exon
chr19:7293803-7293942chr19:7293792-7293931
Coord A exon
chr19:7281424-7281518chr19:7281413-7281507
Coord C2 exon
chr19:7267356-7267907chr19:7267345-7267896
Length
9595 bp
Sequences
Splice sites
3' ss Seq
TTTATTTTTATTTTTTGCAGAGA
3' ss Score
9.26
5' ss Seq
GATGTGAGC
5' ss Score
4.72
Exon sequences
Seq C1 exon
CGCGCGCTCTGATCCGAGGAGACCCCGCGCTCCCGCAGCCATGGCCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAGAGG
CGCGCGCTCTGATCCGAGGAGACCCCGCGCTCCCGCAGCCATGGCCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTGCTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAGAGG
Seq A exon
AGACAGGGTCTGGCTGTGTTGCCCAGGCTGGCCTCGAACTCAAGACCTTAAGTGATCGTCCCGCCTCAGCCTCCCAAAGCACTGGGATTGCAGAT
AGACAGGGTCTGGCTGTGTTGCCCAGGCTGGCCTCGAACTCAAGACCTTAAGTGATCGTCCCGCCTCAGCCTCCCAAAGCACTGGGATTGCAGAT
Seq C2 exon
TGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGGAACTCGGCCTCTACAACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACTGGTCCCGTATCCTGGATTCCGTGGAGGATAATTACATCGTGTTGAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACCAACTGCCCCGCCACCGTC
TGTGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCTGTCATCGAAGGACACTTGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTATGGGCTCGAGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTGTTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGGAACTCGGCCTCTACAACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTACTTGGCCACTATCGACTGGTCCCGTATCCTGGATTCCGTGGAGGATAATTACATCGTGTTGAACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACCAACTGCCCCGCCACCGTC
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000171105-'0-1,'0-0,1-1
Average complexity
SS
Mappability confidence:
100%=100=%
Protein Impact
ORF disruption upon sequence inclusion

No structure available

Features
Disorder rate:
C1=0.353 A=0.000 C2=0.005
 

Domain overlap (PROSITE):

Info
C1:
NO
A:
NO
C2:
PS50311=CYS_RICH=PU(6.9=4.9)
Domain overlap (PFAM):

Info
C1:
NO
A:
NO
C2:
PF0103019=Recep_L_domain=WD(100=61.1),PF0075715=Furin-like=PU(24.1=21.1)

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Mouse:
No conservation detected
Chicken:
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
CTCTGATCCGAGGAGACCCC
R:
AGCTCATGCAACCTAGTGAGG
Band lengths:
183-278
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN