HsaEX0031841

From VastDB

Exon Skipping

Gene
Description
insulin receptor [Source:HGNC Symbol;Acc:6091]
Coordinates
chr19:7167979-7170762:-chr19:7167968-7170751:-
Coord C1 exon
chr19:7170548-7170762chr19:7170537-7170751
Coord A exon
chr19:7169731-7169842chr19:7169720-7169831
Coord C2 exon
chr19:7167979-7168105chr19:7167968-7168094
Length
112112 bp
Sequences
Splice sites
3' ss Seq
ATGCTTACTGTGCCATATAGTAC
3' ss Score
2.47
5' ss Seq
AAAGTTGAG
5' ss Score
-11.32
Exon sequences
Seq C1 exon
GAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGGGAAACTCTTCTTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACATTGCCCTGAAGACCAATGGGGACCAGGCATCCT
GAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGGGAAACTCTTCTTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGAACCAAGGGGCGCCAGGAGAGAAACGACATTGCCCTGAAGACCAATGGGGACCAGGCATCCT
Seq A exon
TACCGGATACGGGATGAAGTCATACAAGCACTGAATGAATGGATGAATGAATGATGGATGAATGGATGACACCTTCTTATATGTGTATCAGGCTGATGCTGAAGACTTCAAA
TACCGGATACGGGATGAAGTCATACAAGCACTGAATGAATGGATGAATGAATGATGGATGAATGGATGACACCTTCTTATATGTGTATCAGGCTGATGCTGAAGACTTCAAA
Seq C2 exon
GTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGCCGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGC
GTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTGAGATGGGAGCCGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTACAAAGAGGC
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000171105-'8-7,'8-6,9-7
Average complexity
SS
Mappability confidence:
100%=100=%
Protein Impact
ORF disruption upon sequence inclusion

Show PDB structure

Features
Disorder rate:
C1=0.000 A=0.000 C2=0.000
 

Domain overlap (PROSITE):

Info
C1:
NO
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
PF0103019=Recep_L_domain=PD(43.5=68.5)
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Mouse:
No conservation detected
Chicken:
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
CTCTGGGACTGGAGCAAACAC
R:
GGCTCCCATCTCAGCAAGATC
Band lengths:
242-354
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN