HsaEX0031843

From VastDB

Exon Skipping

Gene
Description
insulin receptor [Source:HGNC Symbol;Acc:6091]
Coordinates
chr19:7142827-7152938:-chr19:7142816-7152927:-
Coord C1 exon
chr19:7152737-7152938chr19:7152726-7152927
Coord A exon
chr19:7150508-7150543chr19:7150497-7150532
Coord C2 exon
chr19:7142827-7143101chr19:7142816-7143090
Length
3636 bp
Sequences
Splice sites
3' ss Seq
CGTTGGTTTTGTTTCCACAGAAA
3' ss Score
9.85
5' ss Seq
TAGGTATGA
5' ss Score
6.99
Exon sequences
Seq C1 exon
GGCTGAAGCTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCTGTCCAAAGACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGGTTTTCGTCCCCAG
GGCTGAAGCTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCTCAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCTGTCCAAAGACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGATTACCTGCACAACGTGGTTTTCGTCCCCAG
Seq A exon
AAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAG
AAAAACCTCTTCAGGCACTGGTGCCGAGGACCCTAG
Seq C2 exon
GCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACGGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCACGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAG
GCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTGCCCACGGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAGCACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACACTTCACGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGCAGTGTGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000171105_CASSETTE1
Average complexity
SS
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (Ref)

Show PDB structure

Features
Disorder rate:
C1=0.632 A=0.692 C2=0.156
 

Domain overlap (PROSITE):

Info
C1:
PS50853=FN3=PD(24.3=26.5)
A:
PS50853=FN3=PU(4.4=30.8)
C2:
PS50853=FN3=PD(94.5=92.5);
Domain overlap (PFAM):

Info
C1:
NO
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Chicken:
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
GGATTACCTGCACAACGTGGT
R:
CGAGGAAGTGTTGGGGAAAGC
Band lengths:
121-157
Annotated function
There are 20 annotated functions for this event
PMID: 7798270
This event
Inclusion of exon 11 reduces affinity for Ins and allows binding of Igf2.
PMID: 7929288
This event
Both isoforms are cleaved similarly in vitro by the proprotein convertase furin.
PMID: 24389353
This event
Decorin inhibits INSR Ex11(-) IGF-II-mediated biological responses but does not affect insulin-mediated signalling. Experiments preformed in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform).
PMID: 21680660
This event
Different substrates are recruited to INSR Ex11(-) depending on its activation by either insulin or IGF-II binding in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform)
PMID: 25527501
This event
Furin is not essential for INSR Ex11(+) cleavage, instead when furin activity is reduced, proprotein convertase PACE4 cleaves INSR Ex11(+) but not INSR Ex11(-). Experiments preformed in human cell lines HeLa, LoVo, HEK293, and the murine cell line 3T3L1.
PMID: 11500939
This event
IGF-II and insulin have similar time courses and potencies of regulation of mitogenic pathways Akt/Gsk3b and Erk through INSR Ex11(-). Both ligands effectively stimulate cell cycle progression from the G0/G1 to the S and G2/M phase. Experiments preformed in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform).
PMID: 10207053
This event
IGF-II binds and activates INSR Ex11(-) with an affinity close to insulin, but not INSR Ex11(+). Insulin-activated INSR Ex11(-)promotes metabolic effects whereas IGF-II-activated INSR Ex11(-)induces mitogenic effects. Experiments preformed in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform)
PMID: 19443570
This event
IGF-II stimulation of INSR Ex11(-) triggers a higher p70S6K/Akt activation ratio compared to insulin stimulation. IGF-I also triggers a similar signalling pattern as IGF-II, despite inducing minimal INSR Ex11(-) autophosphorylation. Experiments preformed in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform)
PMID: 22318726
This event
IGF-II triggers less INSR Ex11(-) internalization than insulin and it is a more potent mitogen than insulin in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform)
PMID: 21541042
This event
INSR Ex11(+) and INSR Ex11(-) furin recognition sites are different.
PMID: 20061534
This event
INSR Ex11(+) and not INSR Ex11(-) codistributes with PI3K-C2 and PKB /Akt1 in pancreatic beta cells. In response to insulin, PI3K-C2 generates PI(3,4)P2, which allows the selective activation of PKB /Akt1.
PMID: 15650270
This event
Insulin and IGF-II induce a different gene expression profiles by activating INSR Ex11(-) in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform).
PMID: 12447687
This event
Insulin is more potent than IGF-II in activating the INSR Ex11(-)/PI3-K/Akt pathway and in protecting cells from apoptosis whereas IGF-II is more potent than insulin in activating the INSR Ex11(-)/ Shc/ERK pathway and in stimulating cell migration in human myosarcoma cells.
PMID: 22355074
This event
Proinsulin differentially activates the two INSR isoforms. It triggers high autophosphorylation of INSR Ex11(-) and weak autophosphorylation of INSR Ex11(+). Experiments preformed in R_/IR-A and R_/IR-B cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing either the human INSR Ex11(-) isoform or the human INSR Ex11(+) isoform respectively)
PMID: 11463381
(From rat). INSR Ex11(-) pathway promotes activation of the insulin promoter whereas INSR Ex11(+) pathway promotes activation of the beta-cell glucokinase gene promoter in pancreatic islet cells. INSR Ex11(-) and INSR Ex11(+) exhibit different plasma membrane domains in pancreatic islet cells.
PMID: 24398690
IGF-II promotes proliferation and self-renewal of Neural Stem Cells via INSR Ex11(-) and not through activation of either the IGF-1R or the IGF-2R. Experiments preformed using F19A (analog of IGF-II that does not bind the IGF-2R) on mouse neurospheres and in R_/IR-A cells (mouse embryo fibroblasts derived from Igf1r_/_ mice and expressing the human INSR Ex11(-) isoform).
PMID: 12746329
IGF-II-stimulated INSR Ex11(-) induces nuclear IRS-1 translocation and relates to mitogenic and antiapoptotic signals whereas insulin-stimulated INSR Ex11(+) promotes differentiation signals in 32D hemopoietic cells.
PMID: 18172021
INSR isoform balance modulates the susceptibility to apoptosis. INSR deficiency increases susceptibility to apoptosis of immortalized mouse hepatocytes and upon expression of INSR Ex11(-) only, apoptosis is triggered more slowly than upon expression of INSR Ex11(+) only. Coexpression of INSR Ex11(-) and INSR Ex11(+) rescues from apoptosis.
PMID: 23677929
Insulin and proatherogenic stimuli induce higher proliferation in INSR Ex11(-) than INSR Ex11(+) vascular smooth muscle cells.
PMID: 17264162
Insulin-stimulated transcription of c-fos and glucokinase genes is activated simultaneously in insulin-producing beta-cells from different INSR Ex11(+) localization. Insulin activates the glucokinase gene via PI3K- C2 -like/PDK1/PKB from plasma membrane-standing INSR Ex11(+), while c-fos gene activation is dependent on clathrin-mediated INSR Ex11(+) -endocytosis and signaling from early endosomes via PI3K Ia/Shc/MEK1/ERK pathway.


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN