HsaEX0033219

From VastDB

Exon Skipping

Gene
Description
lysine (K)-specific demethylase 1A [Source:HGNC Symbol;Acc:29079]
Coordinates
chr1:23385566-23395174:+chr1:23059073-23068681:+
Coord C1 exon
chr1:23385566-23385660chr1:23059073-23059167
Coord A exon
chr1:23385840-23385851chr1:23059347-23059358
Coord C2 exon
chr1:23395032-23395174chr1:23068539-23068681
Length
1212 bp
Sequences
Splice sites
3' ss Seq
TTAACTCTTGAGCTATGTAGGAA
3' ss Score
-0.36
5' ss Seq
ATTGTATAT
5' ss Score
-4.24
Exon sequences
Seq C1 exon
GAGGGAATCCTATGGCTGTGGTCAGCAAACAAGTAAATATGGAACTGGCCAAGATCAAGCAAAAATGCCCACTTTATGAAGCCAACGGACAAGCT
GAGGGAATCCTATGGCTGTGGTCAGCAAACAAGTAAATATGGAACTGGCCAAGATCAAGCAAAAATGCCCACTTTATGAAGCCAACGGACAAGCT
Seq A exon
GAAAGGATTATT
GAAAGGATTATT
Seq C2 exon
GTTCCTAAAGAGAAAGATGAAATGGTAGAGCAAGAGTTTAACCGGTTGCTAGAAGCTACATCTTACCTTAGTCATCAACTAGACTTCAATGTCCTCAATAATAAGCCTGTGTCCCTTGGCCAGGCATTGGAAGTTGTCATTCA
GTTCCTAAAGAGAAAGATGAAATGGTAGAGCAAGAGTTTAACCGGTTGCTAGAAGCTACATCTTACCTTAGTCATCAACTAGACTTCAATGTCCTCAATAATAAGCCTGTGTCCCTTGGCCAGGCATTGGAAGTTGTCATTCA
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000004487-MICROEX1-1/2
Average complexity
MIC_MMIC_M
Mappability confidence:
NA
Protein Impact
Alternative protein isoforms (Ref)

Show PDB structure

Features
Disorder rate:
C1=0.000 A=0.000 C2=0.111
 

Domain overlap (PROSITE):

Info
C1:
NO
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
PF0159319=Amino_oxidase=FE(5.8=100)
A:
PF0159319=Amino_oxidase=FE(0.6=100)
C2:
PF0159319=Amino_oxidase=FE(8.7=100)

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Chicken:
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
GGAACTGGCCAAGATCAAGCA
R:
AGCAACCGGTTAAACTCTTGCT
Band lengths:
105-117
Annotated function
There are 6 annotated functions for this event
PMID: 29254826
This event
(Review). LSD1-n appears to be important for neurite morphogenesis, synaptogenesis, and proper transcriptional response to neuronal depolarization.
PMID: 29254826
This event
(Review). The biochemical function of the LSD1-n isoform has been debated. The first study reporting this isoform found that LSD1-n acts like the canonical protein to remove H3K4 mono- or di- methylation marks (H3K4me1/2) from a histone peptide with similar efficiency (Zibetti et al., 2010). This first study also carried out X-ray crystallography on the histone-interacting segment of LSD1-n and did not find an altered structure compared to the canonical isoform. An- other study found that LSD1-n associates with a nuclear factor, Svil, which changes its substrate specificity from H3K4me1/2 to H3K9me1/ 2, a repressive histone modification (Laurent et al., 2015). A third group reported that LSD1-n demethylates H4K20me1/2, another mark associated with transcriptionally-repressed regions (Wang et al., 2015). These conflicting data suggest that other unknown regulatory proteins, genomic contexts, or timing in neuron maturation may, in concert, determine the substrate specificity of LSD1-n. The threonine at position 369 of LSD1-n, which is located within the microexon, can be phos- phorylated, leading to conformational changes and disassembly of the LSD1/CoREST complex (Toffolo et al., 2014. Thus, the LSD1 microexon might control dynamics of complex assembly instead of, or in addition to, modulating substrate specificity.
PMID: 25684206
This event
LSD1+8a, does not have the intrinsic capability to demethylate H3K4me2. Instead, LSD1+8a mediates H3K9me2 demethylation in collaboration with supervillin (SVIL). LSD1+8a knockdown increases H3K9me2, but not H3K4me2, levels at its target promoters and compromises neuronal differentiation.
PMID: 26214369
Inclusion confers a new substrate specificity, targeting histone H4 Lys20 methylation, both in vitro and in vivo. Selective genetic ablation of LSD1n (mouse MIC KO) led to deficits in spatial learning and memory, revealing the functional importance of LSD1n in neuronal activity-regulated transcription that is necessary for long-term memory formation
PMID: 20164337
LSD1 isoforms (with and without MmuEX0025260) display in vitro a comparable demethylase activity, yet the inclusion of the sole exon E8a (i.e. MmuEX0025260 reduces LSD1 repressor activity on a reporter gene. The knockdown of neurospecific variants in cortical neurons resulting in the inhibition of neurite maturation, whereas overexpression of the same variants enhances it. Instead, perturbation of LSD1 isoforms that are devoid of the neurospecific exon elicits no morphogenic effect.
PMID: 24111946
The MIC is phosphorilated, leading to conformational changes and disassembly of the LSD1/CoREST complex. I.e. reduces some co-factor interactions (coREST; HDAC1)


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN