HsaEX0038119

From VastDB

Exon Skipping

Gene
Description
muscleblind-like splicing regulator 2 [Source:HGNC Symbol;Acc:16746]
Coordinates
chr13:97999058-98009889:+chr13:97346804-97357635:+
Coord C1 exon
chr13:97999058-97999321chr13:97346804-97347067
Coord A exon
chr13:98009050-98009103chr13:97356796-97356849
Coord C2 exon
chr13:98009736-98009889chr13:97357482-97357635
Length
5454 bp
Sequences
Splice sites
3' ss Seq
TCGCTGCCTGTTATTAAAAGACT
3' ss Score
2.9
5' ss Seq
CTGGTACTT
5' ss Score
4.74
Exon sequences
Seq C1 exon
GTATGCAGGGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCACACCCCGCAGACAGCACCATGATCGACACAAGTGACAACACCGTAACCGTTTGTATGGATTACATAAAGGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTGCAGGCCAAAATCAAAGCTGCGCAGCACCAAGCCAACCAAGCTGCGGTGGCCGCCCAGGCAGCCGCGGCCGCGGCCACAGTCATG
GTATGCAGGGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCACACCCCGCAGACAGCACCATGATCGACACAAGTGACAACACCGTAACCGTTTGTATGGATTACATAAAGGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTGCAGGCCAAAATCAAAGCTGCGCAGCACCAAGCCAACCAAGCTGCGGTGGCCGCCCAGGCAGCCGCGGCCGCGGCCACAGTCATG
Seq A exon
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCAACTGTAGACCTG
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCAACTGTAGACCTG
Seq C2 exon
GCCTTTCCCCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTACCAGCGCGGTCTTTAACCCCAGCGTCTTGCACTACCAGCAGGCTCTCACCAGCGCACAGTTGCAGCAACACGCCGCGTTCATTCCAACAG
GCCTTTCCCCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTACCAGCGCGGTCTTTAACCCCAGCGTCTTGCACTACCAGCAGGCTCTCACCAGCGCACAGTTGCAGCAACACGCCGCGTTCATTCCAACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000139793_MULTIEX1-2/2=1-C2
Average complexity
SS
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (No Ref)

Show PDB structure

Features
Disorder rate:
C1=0.300 A=0.833 C2=0.567
 

Domain overlap (PROSITE):

Info
C1:
PS50103=ZF_C3H1=PD(79.3=26.1),PS50103=ZF_C3H1=WD(100=30.7),PS50310=ALA_RICH=PU(93.8=34.1)
A:
NO
C2:
PS50310=ALA_RICH=PD(0.1=0.0)
Domain overlap (PFAM):

Info
C1:
PF0064219=zf-CCCH=PD(81.5=25.0)
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
TTTCACCCTCCTGCACACTTG
R:
AAGGATGAAGAGCACCAGGGG
Band lengths:
133-187
Annotated function
There are 1 annotated functions for this event
PMID: 21454535
This event
Inferred from MBNL1: The exon 5 and 6 regions are both needed to control the nuclear localization of MBNL1


GENOMIC CONTEXT

UCSC image

INCLUSION PATTERN