MmuEX0028103

From VastDB

Exon Skipping

Gene
Description
muscleblind-like 2 [Source:MGI Symbol;Acc:MGI:2145597]
Coordinates
chr14:120795673-120803954:+chr14:120396451-120404732:+
Coord C1 exon
chr14:120795673-120795826chr14:120396451-120396604
Coord A exon
chr14:120802558-120802593chr14:120403336-120403371
Coord C2 exon
chr14:120803860-120803954chr14:120404638-120404732
Length
3636 bp
Sequences
Splice sites
3' ss Seq
CCCCCATTGCATGACTTCAGGGT
3' ss Score
6.56
5' ss Seq
TTGGTAGGT
5' ss Score
7.03
Exon sequences
Seq C1 exon
GCCTTCCCTCCGGGTGCTCTTCATCCCTTACCAAAGAGACAAGCACTTGAAAAAAGCAACGGGGCCAGCACGGTCTTCAACCCCAGCGTCTTGCACTACCAGCAGGCTCTGACCAGTGCGCAGCTGCAGCAGCACACGGCGTTCATCCCCACAG
GCCTTCCCTCCGGGTGCTCTTCATCCCTTACCAAAGAGACAAGCACTTGAAAAAAGCAACGGGGCCAGCACGGTCTTCAACCCCAGCGTCTTGCACTACCAGCAGGCTCTGACCAGTGCGCAGCTGCAGCAGCACACGGCGTTCATCCCCACAG
Seq A exon
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
Seq C2 exon
TACCCATGATGCACAGCGCTACGTCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTCCCCTTCGCAGCAACAGCCACAGCCAATCAG
TACCCATGATGCACAGCGCTACGTCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTCCCCTTCGCAGCAACAGCCACAGCCAATCAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSMUSG00000022139_MULTIEX2-1/2=C1-2
Average complexity
C2C2
Mappability confidence:
100%=100=%
Protein Impact
Alternative protein isoforms (No Ref)

No structure available

Features
Disorder rate:
C1=0.490 A=0.000 C2=0.438
 

Domain overlap (PROSITE):

Info
C1:
PS50310=ALA_RICH=PD(0.1=0.0)
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
NO
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
CGTCTTGCACTACCAGCAGG
R:
TTGTTGCTGCAGAGACAGTGG
Band lengths:
116-152
Annotated function
There are 1 annotated functions for this event
PMID: 21454535
Inferred from MBNL1 ortholog: The exon 7 region enhances MBNL1-MBNL1 dimerization properties


GENOMIC CONTEXT

UCSC image
UCSC image

INCLUSION PATTERN