MmuEX0028104

From VastDB

Exon Skipping

Gene
Description
muscleblind-like 2 [Source:MGI Symbol;Acc:MGI:2145597]
Coordinates
chr14:120795673-120830919:+chr14:120396451-120431697:+
Coord C1 exon
chr14:120795673-120795826chr14:120396451-120396604
Coord A exon
chr14:120803860-120803954chr14:120404638-120404732
Coord C2 exon
chr14:120828157-120830919chr14:120428935-120431697
Length
9595 bp
Sequences
Splice sites
3' ss Seq
CATGGTTCCCCTCCTGAAAGTAC
3' ss Score
3.97
5' ss Seq
CAGGTTTGC
5' ss Score
4.86
Exon sequences
Seq C1 exon
GCCTTCCCTCCGGGTGCTCTTCATCCCTTACCAAAGAGACAAGCACTTGAAAAAAGCAACGGGGCCAGCACGGTCTTCAACCCCAGCGTCTTGCACTACCAGCAGGCTCTGACCAGTGCGCAGCTGCAGCAGCACACGGCGTTCATCCCCACAG
GCCTTCCCTCCGGGTGCTCTTCATCCCTTACCAAAGAGACAAGCACTTGAAAAAAGCAACGGGGCCAGCACGGTCTTCAACCCCAGCGTCTTGCACTACCAGCAGGCTCTGACCAGTGCGCAGCTGCAGCAGCACACGGCGTTCATCCCCACAG
Seq A exon
TACCCATGATGCACAGCGCTACGTCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTCCCCTTCGCAGCAACAGCCACAGCCAATCAG
TACCCATGATGCACAGCGCTACGTCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTCCCCTTCGCAGCAACAGCCACAGCCAATCAG
Seq C2 exon
ATAATTCTGAAATAATCAACAGAAATGGAATGGAATGCCAAGAATCTGCATTGAGAATAACTAAACATTGTTACTGTACATATTACCCCGTTTCCTCCTCAATAGAATTGCCACAAACTGCATGCTAAATTTAGTTCTTCTGGACAGACCACAACCCTAAGGCTAGTTCTGCTATGTCATATATGAGTATTAAATATGGTATGCTTAGTATACTCCAGCCTAAGATAGTTAACCACCTGAGACCAGCTGTGATGTTCGAAGACATACAGGATGAGGTTTTCTTTCACAGGGTTCTGAGCATAGTTTCTGTCCCAGGAATATTGTCTTATCTCCATAACTATAGCTGATGCAGAAAGTCCAGACAATATACTCATTTCGACTCAGAATATTTCAAATTTAGCAATAAACAGTTAGCTTTAGTTTTAAGTACCTATTCCAAGGGCAGGTTCGATTGTAACTCCAATCACAACCATTTCATTTCCTGACTGGATCGAAGGGTA
ATAATTCTGAAATAATCAACAGAAATGGAATGGAATGCCAAGAATCTGCATTGAGAATAACTAAACATTGTTACTGTACATATTACCCCGTTTCCTCCTCAATAGAATTGCCACAAACTGCATGCTAAATTTAGTTCTTCTGGACAGACCACAACCCTAAGGCTAGTTCTGCTATGTCATATATGAGTATTAAATATGGTATGCTTAGTATACTCCAGCCTAAGATAGTTAACCACCTGAGACCAGCTGTGATGTTCGAAGACATACAGGATGAGGTTTTCTTTCACAGGGTTCTGAGCATAGTTTCTGTCCCAGGAATATTGTCTTATCTCCATAACTATAGCTGATGCAGAAAGTCCAGACAATATACTCATTTCGACTCAGAATATTTCAAATTTAGCAATAAACAGTTAGCTTTAGTTTTAAGTACCTATTCCAAGGGCAGGTTCGATTGTAACTCCAATCACAACCATTTCATTTCCTGACTGGATCGAAGGGTA
VastDB Features
Vast-tools module Information
Secondary ID
ENSMUSG00000022139_MULTIEX2-2/2=C1-C2
Average complexity
C1C1
Mappability confidence:
100%=100=%
Protein Impact
ORF disruption upon sequence exclusion

No structure available

Features
Disorder rate:
C1=0.490 A=0.438 C2=0.212
 

Domain overlap (PROSITE):

Info
C1:
PS50310=ALA_RICH=PD(0.1=0.0)
A:
NO
C2:
NO
Domain overlap (PFAM):

Info
C1:
NO
A:
NO
C2:
NO

Degree:
NA
Betweeness:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
TACCAGCAGGCTCTGACCAG
R:
GCATGCAGTTTGTGGCAATTCT
Band lengths:
183-278
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT

UCSC image
UCSC image

INCLUSION PATTERN