Special

GgaEX1035310 @ galGal4

Exon Skipping

Gene
Description
muscleblind-like 2 isoform 5 [Source:RefSeq peptide;Acc:NP_001156846]
Coordinates
chr1:144576579-144592856:-
Coord C1 exon
chr1:144592762-144592856
Coord A exon
chr1:144587560-144587622
Coord C2 exon
chr1:144576579-144579554
Length
63 bp
Sequences
Splice sites
3' ss Seq
TGCTGCCTATTTCTTGCTAGATA
3' ss Score
8.15
5' ss Seq
CATGTAAGT
5' ss Score
8.31
Exon sequences
Seq C1 exon
TACCCATGATGCACAACGCTACGGCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTTCCCTTCGCCGCAACAGCCACAGCAAATCAG
Seq A exon
ATACCTCAGAATCAGAAGCCTCAACTCAAACCAGTAATAAAGTCTGAAGACACTGAGTCACAT
Seq C2 exon
ATAATCCTGAAGTAATCAGCAGGAACGGGACGGAGTGCCACGAAGCCTCCCTGCGGATGGCCAAGCACGGCTACTGTACATACTATCCTGTCTCCTCCTCTCTAGAATTGCCACAAACTGCATGCTAAGTAAAGAATTTGTTCTTACGGACAAATCACAAACTCTAAAAAGCTAGTGCTGCTATGTCATATATGAATATTAAATATGGTATGCTTACTATACTCCGACCTAAAATAGTTAACTACCTGATACCAGCTGTGATGTTTCAAGACATAAAGGGTAACATTTAGTTTCGAAGATTTTCTAAACATAGTTTAATTCTTGCAAACGTTGTCTTTTCTCCATAACTATACCTAATGGAAATGGTCCAATTGAGTTAGCCTTGGGAGATTCGCTGTTCATGAATCTTTCAAGCTCAGCAATAATTAATTTGTATTGGCTAAAAACATATCCCGGTTGCACGTTTAGTTTTAACCCGAACTATAATTGGGGGTTTTCTT
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX1-3/3=2-C2
Average complexity
C2
Mappability confidence:
100%=100=100%
Protein Impact

Alternative protein isoforms (No Ref)

No structure available
Features
Disorder rate (disopred):
  C1=NA A=NA C2=NA
Domain overlap (PFAM):

C1:
NO
A:
NO
C2:
NO


Main Inclusion Isoform:
ENSGALT00000042993fB9277


Main Skipping Isoform:


Other Inclusion Isoforms:
NA
Associated events
Conservation
Human
(hg38)
No conservation detected
Human
(hg19)
No conservation detected
Mouse
(mm10)
No conservation detected
Mouse
(mm9)
No conservation detected
Cow
(bosTau6)
No conservation detected
Zebrafish
(danRer10)
No conservation detected
Fruitfly
(dm6)
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
TGTCTCTGCAGCAACAACTCC
R:
ATGTACAGTAGCCGTGCTTGG
Band lengths:
145-208
Functional annotations
There are 0 annotated functions for this event


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]