Special

GgaINT1017547 @ galGal4

Intron Retention

Gene
Description
muscleblind-like 2 isoform 5 [Source:RefSeq peptide;Acc:NP_001156846]
Coordinates
chr1:144592762-144594277:-
Coord C1 exon
chr1:144594242-144594277
Coord A exon
chr1:144592857-144594241
Coord C2 exon
chr1:144592762-144592856
Length
1385 bp
Sequences
Splice sites
5' ss Seq
TTGGTAGGT
5' ss Score
7.03
3' ss Seq
CATGGTTCCCCTCCTGAAAGTAC
3' ss Score
3.97
Exon sequences
Seq C1 exon
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
Seq A exon
GTAGGTTCCAAATTTCTTTATTGATCTCTTTTATACTGTATATGATGTATATTCACTTGTTTCAAAACTTGTAGGTGAGATTTAGGCAATGACTAGAACTAAAGGCTCACTTGTCCTTCTGGTTGACTTTGCGCAGTGTTTAGATTTGTAGACGAAAGCTGCAGCTCAGATGTGATGTCACCTGCTATAACAACTATACTGCAAAAGCATAATACCATGAATTCCAGTCTGCTTTTCAGTTTTCAACGTTTTATTTCCCTTTATATTGTCTAGTACTATAAAATCATAAAATACTGGAAAAGCCAGCAAGTTTCATCAGTGTTTTAAAGTTTCATAGTGGTGTGCCTATTTCTCCTTTTTGCTGTGTGTTAGAAAGTTTTATCAGCGTTTCCCAGAAATACCTACTTTGATCCACAAAAGTTTGGTTGAAACCCGTGATATAAATCTCACTCCTCCTTTCAATATGTTTACATCTTGGAACGAACATTTTGGGCATGCCAAATTAAAGCCCAACGTGGCAGACTCTAAGACAGGAAAGTAAGATTTCTCCTGTTCTGTAGCTTCATCCCAGTGATTTCTTTTTGTGGCAGGGGAGGCTGCTCAATAAATGGTTAAAAGATTTTTAAAGGTAAGGTTAGTATTCTCGTACAAGGGTGCTGAGCAATATTCATTCTTAAAATGAGCAAAAGCAGCAGCTTTCACACAATTGATCTTGCTTTTTTAGACCAAACAAAGTAGAATTTAAATCAGGAAAATGGTTATCGTCCTTCTGATTCTTGCCTCAAAGCAGAGGGCAGTTTAACTCTGATAAAGTCTAGCAGTCATGCAGTGCTAGTAGAAAAAAAAACCCACACAAATTGGATTATATAGGAAGACGACGAGTATCTGGCTTACTTCAAAATGAAGACGCACGATAATAACTTGTTTTTAATGCTGTTCAAAAATTAAGATAAACAGTTACCATTTTCCTTCCCAGTTCAAAAGGTTATTTTCAGTAGAGTTTTATTTTGGAGCGATACTGGGGGGAAAAGAAAATGGTGTAGCAGTTCTCAGGTAACGGGTTGTTTTGGTAGAGCCCTACTCTTAGAGATAACGCCCGCATTTGCAGTGGTCTCTGCTCTTTTTTTCTGGGAATCGCCGATCGTGTTGACAACCTTCCTTTAATTGTACTTGTAATAAGCTATTTTCCCTTTTTTTTTTTTTTTTTTTTTTTTTTATTTCTCCGCCACGCTTTCTCGCTTTGCACTGTGATTGCATGCCATCTGCTGGTTTAACCCATGACGATGGCTTGCCGCTCTTGATATTCACCATGCCAAAAATACCACTTCTCTTACCATAATGCTGCACCCTCCTGTTCATTGCTTCCATGGTTCCCCTCCTGAAAG
Seq C2 exon
TACCCATGATGCACAACGCTACGGCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTTCCCTTCGCCGCAACAGCCACAGCAAATCAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890:ENSGALT00000042993:7
Average complexity
IR
Mappability confidence:
NA
Protein Impact

ORF disruption upon sequence inclusion

No structure available
Features
Disorder rate (disopred):
  C1=NA A=NA C2=NA
Domain overlap (PFAM):

C1:
NO
A:
NA
C2:
NO


Main Inclusion Isoform:
NA


Main Skipping Isoform:


Other Inclusion Isoforms:
NA


Other Skipping Isoforms:
Associated events
Conservation
Zebrafish
(danRer10)
ALTERNATIVE
Fruitfly
(dm6)
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
No suggested primer sequences
R:
No suggested primer sequences
Band lengths:
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]