Special

GgaEX0025049 @ galGal4

Exon Skipping

Gene
Description
muscleblind-like 2 isoform 5 [Source:RefSeq peptide;Acc:NP_001156846]
Coordinates
chr1:144592762-144597544:-
Coord C1 exon
chr1:144597391-144597544
Coord A exon
chr1:144594242-144594277
Coord C2 exon
chr1:144592762-144592856
Length
36 bp
Sequences
Splice sites
3' ss Seq
TATCATTGCATGACACGCAGGGT
3' ss Score
3.63
5' ss Seq
TTGGTAGGT
5' ss Score
7.03
Exon sequences
Seq C1 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
Seq A exon
GGTCAGTTTTGTGCATGACACCCGCTACCAGTATTG
Seq C2 exon
TACCCATGATGCACAACGCTACGGCCGCCACTGTCTCTGCAGCAACAACTCCTGCAACAAGTGTTCCCTTCGCCGCAACAGCCACAGCAAATCAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX1-1/3=C1-2
Average complexity
C2
Mappability confidence:
100%=100=100%
Protein Impact

Alternative protein isoforms (Ref)

No structure available
Features
Disorder rate (disopred):
  C1=NA A=NA C2=NA
Domain overlap (PFAM):

C1:
NO
A:
NO
C2:
NO


Main Inclusion Isoform:


Main Skipping Isoform:


Other Inclusion Isoforms:


Other Skipping Isoforms:
Other assemblies
Conservation
Zebrafish
(danRer10)
ALTERNATIVE
Fruitfly
(dm6)
No conservation detected
Primers PCR
Suggestions for RT-PCR validation
F:
CTTGCCAATGCTCAGTTGCAG
R:
GGGAACACTTGTTGCAGGAGT
Band lengths:
114-150
Annotated function
There are 1 annotated functions for this event
PMID: 21454535
Inferred from MBNL1 ortholog: The exon 7 region enhances MBNL1-MBNL1 dimerization properties


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]