Special

BtaEX0021571 @ bosTau6

Exon Skipping

Gene
Description
Bos taurus muscleblind-like 2 (Drosophila) (MBNL2), mRNA. [Source:RefSeq mRNA;Acc:NM_001099710]
Coordinates
chr12:78403069-78409887:+
Coord C1 exon
chr12:78403069-78403332
Coord A exon
chr12:78409040-78409093
Coord C2 exon
chr12:78409734-78409887
Length
54 bp
Sequences
Splice sites
3' ss Seq
TCGCTGCCTGTTATTAAAAGACT
3' ss Score
2.9
5' ss Seq
CTGGTACTT
5' ss Score
4.74
Exon sequences
Seq C1 exon
GTCTGCAGGGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCACACCCCGCCGACAGCACCATGGTCGACACAAACGACAACAGCGTAACCGTTTGTATGGATTACATAAAGGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTGCAGGCCAAAATCAAAGCTGCGCAGCACCAAGCCAACCAGGCCGCGGTGGCCGCCCAGGCAGCCGCGGCCGCGGCCACAGTCATG
Seq A exon
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCATCTGTAGACCTG
Seq C2 exon
GCCTTCCCTCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAACGGTGCGAGCACCGTGTTTAACCCCAGCGTCTTGCAGTACCAGCAGGCTCTCACCAGTGCGCAGCTGCAGCAGCACACCGCGTTCATCCCGACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSBTAG00000018313_CASSETTE1
Average complexity
S
Mappability confidence:
100%=100=100%
Protein Impact

Alternative protein isoforms (Ref)

No structure available
Features
Disorder rate (disopred):
  C1=0.199 A=0.986 C2=0.159
Domain overlap (PFAM):

C1:
PF0064219=zf-CCCH=PD(81.5=25.0)
A:
NO
C2:
NO


Main Inclusion Isoform:


Main Skipping Isoform:
NA


Other Inclusion Isoforms:
NA


Other Skipping Isoforms:
NA
Associated events
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
TTTCACCCTCCTGCACACTTG
R:
AGGATGAAGAGCACCAGGAGG
Band lengths:
132-186
Functional annotations
There are 2 annotated functions for this event
PMID: 21454535
Inferred from MBNL1: The exon 5 and 6 regions are both needed to control the nuclear localization of MBNL1
PMID: 27733504
The presence of alternative ex.54nt always significantly elevated MBNL1 and MBNL2 protein levels (_2.7 and _4.0-times, respectively). There were marginal changes of the GFP-MBNL level for constructs carrying ex.36nt (_1.3-times) and ex.95nt (_0.8-times). There were no significant differences between the activities of the analyzed proteins for the majority (67%) of AS events. However, these exons might have either a positive or negative effect on some specific AS events (Figure 5A and C). Interestingly, exOFF events predominated in AS events with a negative effect of ex.36nt (95%; P = 0.002) and a positive effect of ex.95nt (90%; P = 0.010). All together, these data indicate that the presence of sequences encoded by these alternative exons can significantly modulate MBNL splicing activity, but this regulation depends strongly on the targeted RNA.


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]


SPECIAL DATASETS

  • Pre-implantation embryo development