Special

HsaEX0038119 @ hg38

Exon Skipping

Gene
Description
muscleblind like splicing regulator 2 [Source:HGNC Symbol;Acc:HGNC:16746]
Coordinates
chr13:97346804-97357635:+
Coord C1 exon
chr13:97346804-97347067
Coord A exon
chr13:97356796-97356849
Coord C2 exon
chr13:97357482-97357635
Length
54 bp
Sequences
Splice sites
3' ss Seq
TCGCTGCCTGTTATTAAAAGACT
3' ss Score
2.9
5' ss Seq
CTGGTACTT
5' ss Score
4.74
Exon sequences
Seq C1 exon
GTATGCAGGGAGTTCCAGCGAGGAAACTGTGCCCGGGGAGAGACCGACTGCCGCTTTGCACACCCCGCAGACAGCACCATGATCGACACAAGTGACAACACCGTAACCGTTTGTATGGATTACATAAAGGGGCGTTGCATGAGGGAGAAATGCAAATATTTTCACCCTCCTGCACACTTGCAGGCCAAAATCAAAGCTGCGCAGCACCAAGCCAACCAAGCTGCGGTGGCCGCCCAGGCAGCCGCGGCCGCGGCCACAGTCATG
Seq A exon
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCAACTGTAGACCTG
Seq C2 exon
GCCTTTCCCCCTGGTGCTCTTCATCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTACCAGCGCGGTCTTTAACCCCAGCGTCTTGCACTACCAGCAGGCTCTCACCAGCGCACAGTTGCAGCAACACGCCGCGTTCATTCCAACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSG00000139793_MULTIEX3-4/4=3-C2
Average complexity
S
Mappability confidence:
100%=100=100%
Protein Impact

Alternative protein isoforms (No Ref)

Show PDB structure
Features
Disorder rate (disopred):
  C1=0.280 A=0.833 C2=0.519
Domain overlap (PFAM):

C1:
PF0064219=zf-CCCH=PD(81.5=25.0)
A:
NO
C2:
NO


Main Inclusion Isoform:


Main Skipping Isoform:


Other Inclusion Isoforms:
NA


Other Skipping Isoforms:
Associated events
Other assemblies
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
TTTCACCCTCCTGCACACTTG
R:
AAGGATGAAGAGCACCAGGGG
Band lengths:
133-187
Functional annotations
There are 2 annotated functions for this event
PMID: 21454535
Inferred from MBNL1: The exon 5 and 6 regions are both needed to control the nuclear localization of MBNL1
PMID: 27733504
The presence of alternative ex.54nt always significantly elevated MBNL1 and MBNL2 protein levels (_2.7 and _4.0-times, respectively). There were marginal changes of the GFP-MBNL level for constructs carrying ex.36nt (_1.3-times) and ex.95nt (_0.8-times). There were no significant differences between the activities of the analyzed proteins for the majority (67%) of AS events. However, these exons might have either a positive or negative effect on some specific AS events (Figure 5A and C). Interestingly, exOFF events predominated in AS events with a negative effect of ex.36nt (95%; P = 0.002) and a positive effect of ex.95nt (90%; P = 0.010). All together, these data indicate that the presence of sequences encoded by these alternative exons can significantly modulate MBNL splicing activity, but this regulation depends strongly on the targeted RNA.


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]


SPECIAL DATASETS

  • The Cancer Genome Atlas (TCGA)
  • Genotype-Tissue Expression Project (GTEx)
  • Autistic and control brains
  • Pre-implantation embryo development