Special

GgaEX0025048 @ galGal4

Exon Skipping

Gene
Description
muscleblind-like 2 isoform 5 [Source:RefSeq peptide;Acc:NP_001156846]
Coordinates
chr1:144597391-144602663:-
Coord C1 exon
chr1:144602400-144602663
Coord A exon
chr1:144598195-144598248
Coord C2 exon
chr1:144597391-144597544
Length
54 bp
Sequences
Splice sites
3' ss Seq
TCGCTGCCTGTTATTAAAAGACT
3' ss Score
2.9
5' ss Seq
CTGGTACTT
5' ss Score
4.74
Exon sequences
Seq C1 exon
GTGTGCAGGGAGTTCCAGAGGGGAAACTGTGCGCGTGGAGAGACTGATTGCCGCTTTGCACATCCGGCAGACAGCACAATGATTGACACAAACGACAACACCGTAACCGTGTGTATGGATTACATAAAAGGTCGTTGCATGAGGGAGAAATGCAAGTATTTTCACCCTCCTGCACATTTGCAGGCCAAAATCAAAGCGGCGCAACATCAAGCTAACCAGGCTGCAGTGGCAGCCCAGGCAGCTGCGGCAGCTGCGACTGTGATG
Seq A exon
ACTCAGTCGACTGCCAAAGCAATGAAGCGACCTCTCGAAGCAACTGTAGACCTG
Seq C2 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX2-4/4=3-C2
Average complexity
S
Mappability confidence:
100%=100=100%
Protein Impact

Alternative protein isoforms (Ref)

Show structural model
Features
Disorder rate (disopred):
  C1=NA A=NA C2=NA
Domain overlap (PFAM):

C1:
PF0064219=zf-CCCH=PD(81.5=25.0)
A:
PF0273412=Dak2=PD(18.0=88.9)
C2:
NO


Main Inclusion Isoform:


Main Skipping Isoform:


Other Inclusion Isoforms:


Other Skipping Isoforms:
Other assemblies
Conservation
Primers PCR
Suggestions for RT-PCR validation
F:
ACATCAAGCTAACCAGGCTGC
R:
GATTGAAAACGGCACTGGCAC
Band lengths:
143-197
Annotated function
There are 1 annotated functions for this event
PMID: 21454535
Inferred from MBNL1: The exon 5 and 6 regions are both needed to control the nuclear localization of MBNL1


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]