Special

GgaEX0025047 @ galGal4

Exon Skipping

Gene
Description
muscleblind-like 2 isoform 5 [Source:RefSeq peptide;Acc:NP_001156846]
Coordinates
chr1:144597391-144607737:-
Coord C1 exon
chr1:144607573-144607737
Coord A exon
chr1:144603731-144603931
Coord C2 exon
chr1:144597391-144597544
Length
201 bp
Sequences
Splice sites
3' ss Seq
TCTGTGTTTTCATTTTGCAGCCC
3' ss Score
11.02
5' ss Seq
GAGGTACTG
5' ss Score
7.67
Exon sequences
Seq C1 exon
GGTCGTTGTACAAGGGAGAACTGCAAGTACCTTCACCCACCAACGCATTTAAAAACTCAACTGGAAATCAATGGCAGGAACAACTTAATCCAACAAAAAACTGCAGCAGCTATGCTTGCACAGCAAATGCAGTTCATGTTTCCAGGAACCCCACTACAGCCAGTG
Seq A exon
CCCACATTTCCAGTGGGTCCCACAATAGGAACGAACACGGCTATTAGCTTTGCTCCGTACCTAACGCCAGTAACACCAGGAGTTGGCTTAGTCCCGACTGAGATCCTGCCCACGCCACCCGTCATTGTTCCTGGAAGCCCACCGGTTTCAGTCCCTGGTTCTACTGCTACTCAGAAACTCCTCAGGACTGATAAACTGGAG
Seq C2 exon
GCCTTTCCTCCCGGTGTTCTTCACCCTTTACCAAAGAGACAAGCACTTGAAAAAAGCAATGGTGCCAGTGCCGTTTTCAATCCCAGTGTCTTGCACTATCAACAGGCTCTTGCCAATGCTCAGTTGCAGCAACATGCAGCGTTCATCCCGACAG
VastDB Features
Vast-tools module Information
Secondary ID
ENSGALG00000016890_MULTIEX2-1/4=C1-C2
Average complexity
C3
Mappability confidence:
100%=100=100%
Protein Impact

Alternative protein isoforms (Ref)

Show structural model
Features
Disorder rate (disopred):
  C1=NA A=NA C2=NA
Domain overlap (PFAM):

C1:
NO
A:
PF0273412=Dak2=PU(9.0=11.9),PF0064219=zf-CCCH=PU(11.1=4.5)
C2:
NO


Main Inclusion Isoform:


Main Skipping Isoform:


Other Skipping Isoforms:
NA
Other assemblies
Primers PCR
Suggestions for RT-PCR validation
F:
CTGCAAGTACCTTCACCCACC
R:
GATGAACGCTGCATGTTGCTG
Band lengths:
292-493
Annotated function
There are 0 annotated functions for this event


GENOMIC CONTEXT[edit]

INCLUSION PATTERN[edit]